Transcript: Human NM_013347.4

Homo sapiens replication protein A4 (RPA4), mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
RPA4 (29935)
Length:
1560
CDS:
404..1189

Additional Resources:

NCBI RefSeq record:
NM_013347.4
NBCI Gene record:
RPA4 (29935)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_013347.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000413576 GCATCCAGCTGTGAGTAATTT pLKO_005 1227 3UTR 100% 15.000 21.000 N RPA4 n/a
2 TRCN0000424719 ACGATGAGAGTCACCGCAATT pLKO_005 981 CDS 100% 10.800 15.120 N RPA4 n/a
3 TRCN0000163341 GTCGTGATACCACTGTAGAAA pLKO.1 918 CDS 100% 5.625 7.875 N RPA4 n/a
4 TRCN0000161779 CGGAGTATATGTCAAAGTGTT pLKO.1 766 CDS 100% 4.950 6.930 N RPA4 n/a
5 TRCN0000160753 CGGTGATGGATAAATTGACAA pLKO.1 1375 3UTR 100% 4.950 3.960 N RPA4 n/a
6 TRCN0000164401 CCATCAAGGAAGCGATTGATT pLKO.1 1104 CDS 100% 0.563 0.450 N RPA4 n/a
7 TRCN0000423528 ATATTCTGGAAACGGTCAATG pLKO_005 873 CDS 100% 10.800 7.560 N RPA4 n/a
8 TRCN0000162642 CTAGCAAGCTAATGGAAACAT pLKO.1 1410 3UTR 100% 5.625 3.938 N RPA4 n/a
9 TRCN0000161010 GTAGGATTTACTAGCAAGCTA pLKO.1 1400 3UTR 100% 3.000 2.100 N RPA4 n/a
10 TRCN0000163553 GCGATTGATTATCTGACCGTT pLKO.1 1115 CDS 100% 2.640 1.848 N RPA4 n/a
11 TRCN0000162300 CATCAAGGAAGCGATTGATTA pLKO.1 1105 CDS 100% 1.320 0.924 N RPA4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_013347.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03111 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03111 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000473901 TGTACTCGCCCTGCGTCCTGCCTC pLX_317 58.9% 100% 100% V5 n/a
Download CSV