Transcript: Human NM_013348.4

Homo sapiens potassium inwardly rectifying channel subfamily J member 14 (KCNJ14), mRNA.

Source:
NCBI, updated 2019-09-15
Taxon:
Homo sapiens (human)
Gene:
KCNJ14 (3770)
Length:
3854
CDS:
341..1651

Additional Resources:

NCBI RefSeq record:
NM_013348.4
NBCI Gene record:
KCNJ14 (3770)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_013348.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000418061 TGCAACGTGCGTTTCGTAAAC pLKO_005 515 CDS 100% 10.800 15.120 N KCNJ14 n/a
2 TRCN0000044574 CGCGGTCGCTTCGTCAAGAAA pLKO.1 485 CDS 100% 1.875 2.625 N KCNJ14 n/a
3 TRCN0000044576 CGCCACTTCCATCGCACTTAT pLKO.1 1379 CDS 100% 13.200 10.560 N KCNJ14 n/a
4 TRCN0000044573 CCACAGCCTCAAGTCTAGTTT pLKO.1 1462 CDS 100% 5.625 3.938 N KCNJ14 n/a
5 TRCN0000044575 GATGAGACTGAGGAAGGGAAT pLKO.1 1556 CDS 100% 4.050 2.835 N KCNJ14 n/a
6 TRCN0000044577 GCGCTGGATGTGCCTGCTCTT pLKO.1 598 CDS 100% 0.000 0.000 N KCNJ14 n/a
7 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3211 3UTR 100% 5.625 2.813 Y KLHL30 n/a
8 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3211 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_013348.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00897 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00897 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000478066 TTGCCTTCCAGAGATTTTCTGTTT pLX_317 10% 100% 100% V5 n/a
Download CSV