Transcript: Human NM_013373.4

Homo sapiens zinc finger DHHC-type containing 8 (ZDHHC8), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-29
Taxon:
Homo sapiens (human)
Gene:
ZDHHC8 (29801)
Length:
5049
CDS:
145..2442

Additional Resources:

NCBI RefSeq record:
NM_013373.4
NBCI Gene record:
ZDHHC8 (29801)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_013373.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000163732 GTTTGAAGCCGCCTTTCCTTA pLKO.1 935 CDS 100% 4.950 6.930 N ZDHHC8 n/a
2 TRCN0000162143 CAAGTAAGCTTAATGGGCAGT pLKO.1 2297 CDS 100% 2.160 3.024 N ZDHHC8 n/a
3 TRCN0000164186 CCCAAGTAAGCTTAATGGGCA pLKO.1 2295 CDS 100% 0.660 0.924 N ZDHHC8 n/a
4 TRCN0000219918 TACACGGCACACGCTGGTTAA pLKO.1 2376 CDS 100% 10.800 7.560 N ZDHHC8 n/a
5 TRCN0000162216 CAAGGTCAAGCTTAGTGACAA pLKO.1 987 CDS 100% 4.950 3.465 N ZDHHC8 n/a
6 TRCN0000162999 GCTGTACAAGAACGTGGATGT pLKO.1 411 CDS 100% 4.050 2.835 N ZDHHC8 n/a
7 TRCN0000159522 CAAAGCCTTAACCTTTGCTTT pLKO.1 3141 3UTR 100% 0.495 0.347 N ZDHHC8 n/a
8 TRCN0000162423 CACCTGCCATGTACAAGTTTA pLKO.1 1196 CDS 100% 13.200 7.920 N ZDHHC8 n/a
9 TRCN0000161745 CAATGGCATCATCTTCCTCTT pLKO.1 294 CDS 100% 4.050 2.430 N ZDHHC8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_013373.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13261 pDONR223 100% 13.2% 12.4% None (many diffs) n/a
2 ccsbBroad304_13261 pLX_304 0% 13.2% 12.4% V5 (many diffs) n/a
3 TRCN0000491604 GCGTCTCGTGCTCTTGGCTTGCGG pLX_317 98.3% 13.2% 12.4% V5 (many diffs) n/a
Download CSV