Transcript: Human NM_013388.6

Homo sapiens prolactin regulatory element binding (PREB), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
PREB (10113)
Length:
2127
CDS:
216..1469

Additional Resources:

NCBI RefSeq record:
NM_013388.6
NBCI Gene record:
PREB (10113)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_013388.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000107830 GCTGGCCTAAAGATGCAATAA pLKO.1 1996 3UTR 100% 13.200 18.480 N PREB n/a
2 TRCN0000300904 GCTGGCCTAAAGATGCAATAA pLKO_005 1996 3UTR 100% 13.200 18.480 N PREB n/a
3 TRCN0000107833 TGTGTGCTTCAACCACGATAA pLKO.1 692 CDS 100% 10.800 15.120 N PREB n/a
4 TRCN0000300905 TGTGTGCTTCAACCACGATAA pLKO_005 692 CDS 100% 10.800 15.120 N PREB n/a
5 TRCN0000107832 GCTAGAACTCAGGGTAGAGAA pLKO.1 623 CDS 100% 4.950 6.930 N PREB n/a
6 TRCN0000300906 GCTAGAACTCAGGGTAGAGAA pLKO_005 623 CDS 100% 4.950 6.930 N PREB n/a
7 TRCN0000107834 GTGTGCTTCAACCACGATAAT pLKO.1 693 CDS 100% 13.200 10.560 N PREB n/a
8 TRCN0000107831 CGACTCTTCACAGTGCAAATT pLKO.1 1002 CDS 100% 13.200 9.240 N PREB n/a
9 TRCN0000300972 CGACTCTTCACAGTGCAAATT pLKO_005 1002 CDS 100% 13.200 9.240 N PREB n/a
10 TRCN0000084444 GCATAAAGAATGGCGTGCATT pLKO.1 334 CDS 100% 4.950 3.465 N Preb n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_013388.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02319 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02319 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000470073 CTTGCCACCAGACGTTGAATCATC pLX_317 33.4% 100% 100% V5 n/a
4 ccsbBroadEn_15693 pDONR223 0% 82.7% 82.7% None 1_216del n/a
5 ccsbBroad304_15693 pLX_304 0% 82.7% 82.7% V5 1_216del n/a
Download CSV