Transcript: Mouse NM_013649.3

Mus musculus receptor-like tyrosine kinase (Ryk), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Ryk (20187)
Length:
3267
CDS:
137..1921

Additional Resources:

NCBI RefSeq record:
NM_013649.3
NBCI Gene record:
Ryk (20187)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_013649.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000023719 CCACGCACTTTATCAGTGTTT pLKO.1 527 CDS 100% 4.950 6.930 N Ryk n/a
2 TRCN0000278116 CCACGCACTTTATCAGTGTTT pLKO_005 527 CDS 100% 4.950 6.930 N Ryk n/a
3 TRCN0000023720 GCAAATTAGTAGAAGCCAATA pLKO.1 1374 CDS 100% 10.800 8.640 N Ryk n/a
4 TRCN0000278118 GCAAATTAGTAGAAGCCAATA pLKO_005 1374 CDS 100% 10.800 8.640 N Ryk n/a
5 TRCN0000023723 GAGCTTTACTATGTGAGAAAT pLKO.1 332 CDS 100% 13.200 9.240 N Ryk n/a
6 TRCN0000278185 GAGCTTTACTATGTGAGAAAT pLKO_005 332 CDS 100% 13.200 9.240 N Ryk n/a
7 TRCN0000023722 GCTCTGGAAAGTCTGGTTAAT pLKO.1 1625 CDS 100% 13.200 9.240 N Ryk n/a
8 TRCN0000278119 GCTCTGGAAAGTCTGGTTAAT pLKO_005 1625 CDS 100% 13.200 9.240 N Ryk n/a
9 TRCN0000195387 CGGATAGAGAAGAACGACTTG pLKO.1 1001 CDS 100% 4.050 2.835 N RYK n/a
10 TRCN0000023721 GCGGATAGAGAAGAACGACTT pLKO.1 1000 CDS 100% 4.050 2.835 N Ryk n/a
11 TRCN0000278182 GCGGATAGAGAAGAACGACTT pLKO_005 1000 CDS 100% 4.050 2.835 N Ryk n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_013649.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489927 GTCACAAGTAGCACTAAGCGGGGT pLX_317 23.5% 87.9% 92.7% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000489953 TAAGCATATTTTGAGATTGTTATT pLX_317 22.5% 87.9% 92.6% V5 (many diffs) n/a
Download CSV