Transcript: Mouse NM_013653.3

Mus musculus chemokine (C-C motif) ligand 5 (Ccl5), mRNA.

Source:
NCBI, updated 2017-06-14
Taxon:
Mus musculus (mouse)
Gene:
Ccl5 (20304)
Length:
579
CDS:
58..333

Additional Resources:

NCBI RefSeq record:
NM_013653.3
NBCI Gene record:
Ccl5 (20304)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_013653.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000068100 CGTGTTTGTCACTCGAAGGAA pLKO.1 243 CDS 100% 3.000 4.200 N Ccl5 n/a
2 TRCN0000068098 TCTTGATTCTGACCCTGTATA pLKO.1 345 3UTR 100% 13.200 9.240 N Ccl5 n/a
3 TRCN0000068101 CCACGTCAAGGAGTATTTCTA pLKO.1 192 CDS 100% 5.625 3.938 N Ccl5 n/a
4 TRCN0000068099 CCAGAGAAGAAGTGGGTTCAA pLKO.1 283 CDS 100% 4.950 3.465 N Ccl5 n/a
5 TRCN0000068102 CTCCAATCTTGCAGTCGTGTT pLKO.1 228 CDS 100% 4.050 2.835 N Ccl5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_013653.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01498 pDONR223 100% 85.3% 80.2% None (many diffs) n/a
2 ccsbBroad304_01498 pLX_304 0% 85.3% 80.2% V5 (many diffs) n/a
3 TRCN0000470120 TGTCAGCACTGACAAGGCTACTTA pLX_317 100% 85.3% 80.2% V5 (many diffs) n/a
Download CSV