Transcript: Mouse NM_013716.2

Mus musculus GTPase activating protein (SH3 domain) binding protein 1 (G3bp1), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
G3bp1 (27041)
Length:
2685
CDS:
69..1466

Additional Resources:

NCBI RefSeq record:
NM_013716.2
NBCI Gene record:
G3bp1 (27041)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_013716.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000279148 TCTCGGAATAGTCTATTATAA pLKO_005 1546 3UTR 100% 15.000 21.000 N G3bp1 n/a
2 TRCN0000028946 CCGGACATGTTGCACAGATTT pLKO.1 147 CDS 100% 13.200 18.480 N G3bp1 n/a
3 TRCN0000279239 TGGGCATCTGTGACGAGTAAG pLKO_005 813 CDS 100% 10.800 15.120 N G3bp1 n/a
4 TRCN0000028945 CCTTAGTAATAGGCCCATCAT pLKO.1 1244 CDS 100% 4.950 6.930 N G3bp1 n/a
5 TRCN0000279213 GGTGGGAAGTTACCCAATTTC pLKO_005 1182 CDS 100% 13.200 9.240 N G3bp1 n/a
6 TRCN0000028944 GCCTGATGATTCTGGAACTTT pLKO.1 566 CDS 100% 5.625 3.938 N G3bp1 n/a
7 TRCN0000314494 GCCTGATGATTCTGGAACTTT pLKO_005 566 CDS 100% 5.625 3.938 N G3bp1 n/a
8 TRCN0000028947 CCTCAGAGAGATCAGAGAGTT pLKO.1 951 CDS 100% 4.950 3.465 N G3bp1 n/a
9 TRCN0000279210 CCTCAGAGAGATCAGAGAGTT pLKO_005 951 CDS 100% 4.950 3.465 N G3bp1 n/a
10 TRCN0000028948 GCAGAAGGAAATCCACAGGAA pLKO.1 239 CDS 100% 2.640 1.848 N G3bp1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_013716.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02330 pDONR223 100% 86% 93.3% None (many diffs) n/a
2 ccsbBroad304_02330 pLX_304 0% 86% 93.3% V5 (many diffs) n/a
3 TRCN0000470072 TAGACTACAACTTGTACGTGCAAT pLX_317 19.5% 86% 93.3% V5 (many diffs) n/a
Download CSV