Transcript: Mouse NM_013791.2

Mus musculus muskelin 1, intracellular mediator containing kelch motifs (Mkln1), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Mkln1 (27418)
Length:
3973
CDS:
30..2237

Additional Resources:

NCBI RefSeq record:
NM_013791.2
NBCI Gene record:
Mkln1 (27418)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_013791.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000091688 GCATACAATTTACAGGCATTT pLKO.1 3223 3UTR 100% 10.800 15.120 N Mkln1 n/a
2 TRCN0000091692 GCCCATCAACTCGTTTATGAT pLKO.1 1785 CDS 100% 5.625 4.500 N Mkln1 n/a
3 TRCN0000424605 GACTTGGTGCTGTAGGAATTT pLKO_005 2579 3UTR 100% 13.200 9.240 N Mkln1 n/a
4 TRCN0000091691 GCATGACAAATTGGTGTTAAA pLKO.1 665 CDS 100% 13.200 9.240 N Mkln1 n/a
5 TRCN0000428374 TAGCCTTTAAGAATTAGTAAG pLKO_005 2479 3UTR 100% 10.800 7.560 N Mkln1 n/a
6 TRCN0000091689 GCGGAGACAAATCTACACATT pLKO.1 1037 CDS 100% 4.950 3.465 N Mkln1 n/a
7 TRCN0000091690 GCCCAGCTTTAACTTTAGCAT pLKO.1 449 CDS 100% 3.000 2.100 N Mkln1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_013791.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06584 pDONR223 100% 92.9% 99.1% None (many diffs) n/a
2 ccsbBroad304_06584 pLX_304 0% 92.9% 99.1% V5 (many diffs) n/a
Download CSV