Transcript: Mouse NM_013898.3

Mus musculus translocase of inner mitochondrial membrane 8A1 (Timm8a1), mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Timm8a1 (30058)
Length:
1243
CDS:
83..376

Additional Resources:

NCBI RefSeq record:
NM_013898.3
NBCI Gene record:
Timm8a1 (30058)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_013898.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000240791 GCACCAGATGACGGAACTTTG pLKO_005 190 CDS 100% 10.800 8.640 N Timm8a1 n/a
2 TRCN0000240790 CCTATACTGTGACTTACTTAA pLKO_005 909 3UTR 100% 13.200 9.240 N Timm8a1 n/a
3 TRCN0000240792 TACAAGCCAGTTCATCTTAAA pLKO_005 298 CDS 100% 13.200 9.240 N Timm8a1 n/a
4 TRCN0000233012 TCTGACTGATCTCAGCATTAC pLKO_005 368 CDS 100% 10.800 7.560 N TIMM8A n/a
5 TRCN0000194177 GTTGAACGCTTCATTGATACA pLKO.1 281 CDS 100% 4.950 3.465 N Timm8a1 n/a
6 TRCN0000240789 ACTGCGTTGAACGCTTCATTG pLKO_005 276 CDS 100% 10.800 6.480 N Timm8a1 n/a
7 TRCN0000063982 CTTCATTGATACAAGCCAGTT pLKO.1 289 CDS 100% 4.050 2.430 N TIMM8A n/a
8 TRCN0000175358 CTTCATTGATACAAGCCAGTT pLKO.1 289 CDS 100% 4.050 2.430 N Timm8a1 n/a
9 TRCN0000173310 GCTTCATTGATACAAGCCAGT pLKO.1 288 CDS 100% 2.160 1.296 N Timm8a1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_013898.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00439 pDONR223 100% 90.4% 94.8% None (many diffs) n/a
2 ccsbBroad304_00439 pLX_304 0% 90.4% 94.8% V5 (many diffs) n/a
3 TRCN0000467677 GTTGTCACGTCCACTGCCCATTAA pLX_317 100% 90.4% 94.8% V5 (many diffs) n/a
Download CSV