Transcript: Mouse NM_013933.3

Mus musculus vesicle-associated membrane protein, associated protein A (Vapa), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Vapa (30960)
Length:
1658
CDS:
258..1007

Additional Resources:

NCBI RefSeq record:
NM_013933.3
NBCI Gene record:
Vapa (30960)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_013933.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000093611 GCCGTGTCCTTCAGAGATAAT pLKO.1 906 CDS 100% 13.200 18.480 N Vapa n/a
2 TRCN0000317567 GCCGTGTCCTTCAGAGATAAT pLKO_005 906 CDS 100% 13.200 18.480 N Vapa n/a
3 TRCN0000375334 GTTGCACATTCAGTCCTTTAT pLKO_005 1263 3UTR 100% 13.200 18.480 N Vapa n/a
4 TRCN0000093612 CCACACAGTGTTTCACTCAAT pLKO.1 741 CDS 100% 4.950 3.960 N Vapa n/a
5 TRCN0000093610 CCCTTTGATTATGATCCGAAT pLKO.1 501 CDS 100% 4.050 3.240 N Vapa n/a
6 TRCN0000093613 ACAGATGTAGTCACTACAAAT pLKO.1 345 CDS 100% 13.200 9.240 N Vapa n/a
7 TRCN0000317486 ACAGATGTAGTCACTACAAAT pLKO_005 345 CDS 100% 13.200 9.240 N Vapa n/a
8 TRCN0000313906 CAAGCGACTCCAGGGAGAAAT pLKO_005 794 CDS 100% 13.200 9.240 N Vapa n/a
9 TRCN0000380852 CCCTCCTTCAGACCTCAAATT pLKO_005 311 CDS 100% 13.200 9.240 N Vapa n/a
10 TRCN0000093609 GCTAATATCATGGCAGAATTT pLKO.1 1513 3UTR 100% 13.200 9.240 N Vapa n/a
11 TRCN0000380637 GCTAATATCATGGCAGAATTT pLKO_005 1513 3UTR 100% 13.200 9.240 N VAPA n/a
12 TRCN0000293262 TTTGTGTGTACAGCGTCATAT pLKO_005 1137 3UTR 100% 13.200 9.240 N VAPA n/a
13 TRCN0000381927 TTTGTGTGTACAGCGTCATAT pLKO_005 1137 3UTR 100% 13.200 9.240 N Vapa n/a
14 TRCN0000382165 AGATTTGTTTACCTACCATTT pLKO_005 1067 3UTR 100% 10.800 7.560 N Vapa n/a
15 TRCN0000341259 TGGATTCTTTCTAGGGAAATT pLKO_005 977 CDS 100% 13.200 6.600 Y Mospd4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_013933.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11349 pDONR223 100% 89% 92.3% None (many diffs) n/a
2 ccsbBroad304_11349 pLX_304 0% 89% 92.3% V5 (many diffs) n/a
3 TRCN0000492044 ATTCCAACAAAGTTCTAGCTCCCC pLX_317 56.1% 89% 92.3% V5 (many diffs) n/a
Download CSV