Transcript: Human NM_013938.1

Homo sapiens olfactory receptor family 10 subfamily H member 3 (OR10H3), mRNA.

Source:
NCBI, updated 2019-05-04
Taxon:
Homo sapiens (human)
Gene:
OR10H3 (26532)
Length:
951
CDS:
1..951

Additional Resources:

NCBI RefSeq record:
NM_013938.1
NBCI Gene record:
OR10H3 (26532)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_013938.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000009285 ACTGCATTACAACATGCTAAT pLKO.1 390 CDS 100% 10.800 7.560 N OR10H3 n/a
2 TRCN0000356458 GACTTTCTCCACTTGTGTATC pLKO_005 714 CDS 100% 10.800 7.560 N OR10H3 n/a
3 TRCN0000009288 CTTCTTATCATGGCCACAGTT pLKO.1 130 CDS 100% 4.950 3.465 N OR10H3 n/a
4 TRCN0000356459 ACCCACTGCATTACAACATGC pLKO_005 386 CDS 100% 4.050 2.835 N OR10H3 n/a
5 TRCN0000356432 CTCTTCACCCATCGTTCCATC pLKO_005 259 CDS 100% 4.050 2.835 N OR10H3 n/a
6 TRCN0000009289 CCACAGTTTGGATTGAACGCA pLKO.1 143 CDS 100% 0.750 0.525 N OR10H3 n/a
7 TRCN0000356460 CATTGCTTGGCAACCTTCTTA pLKO_005 116 CDS 100% 5.625 3.375 N OR10H3 n/a
8 TRCN0000009286 GCCTCCCTTATCTACCTCAAA pLKO.1 769 CDS 100% 4.950 2.970 N OR10H3 n/a
9 TRCN0000186332 CAAGACATCATCTGTCATCAT pLKO.1 576 CDS 100% 4.950 2.475 Y OR10H4 n/a
10 TRCN0000009287 CCTCACTTTCTGTGGGTCTAA pLKO.1 498 CDS 100% 4.950 2.475 Y OR10H3 n/a
11 TRCN0000204260 CTCTTGAAGTTGGCCTGTGAA pLKO.1 553 CDS 100% 4.950 2.475 Y OR10H4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_013938.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08025 pDONR223 100% 99.8% 99.6% None 670G>A n/a
2 TRCN0000472302 GTTATGCCCCTGGCAACTCACCGG pLX_317 34.3% 99.8% 99.6% V5 670G>A n/a
Download CSV