Transcript: Human NM_013943.3

Homo sapiens chloride intracellular channel 4 (CLIC4), mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
CLIC4 (25932)
Length:
4253
CDS:
108..869

Additional Resources:

NCBI RefSeq record:
NM_013943.3
NBCI Gene record:
CLIC4 (25932)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_013943.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000044358 GCCGTAATGTTGAACAGAATT pLKO.1 4037 3UTR 100% 0.000 0.000 N CLIC4 n/a
2 TRCN0000300975 GCCGTAATGTTGAACAGAATT pLKO_005 4037 3UTR 100% 0.000 0.000 N CLIC4 n/a
3 TRCN0000044361 GATGGCAATGAAATGACATTA pLKO.1 645 CDS 100% 13.200 9.240 N CLIC4 n/a
4 TRCN0000300908 GATGGCAATGAAATGACATTA pLKO_005 645 CDS 100% 13.200 9.240 N CLIC4 n/a
5 TRCN0000336824 TATGCCCTCCCAAGTACTTAA pLKO_005 403 CDS 100% 13.200 9.240 N CLIC4 n/a
6 TRCN0000044359 CCCACCATTTATAACTTTCAA pLKO.1 329 CDS 100% 5.625 3.938 N CLIC4 n/a
7 TRCN0000044362 CCCAGTGATAAGGAGGTTGAA pLKO.1 810 CDS 100% 4.950 3.465 N CLIC4 n/a
8 TRCN0000366441 CTCATCGAGCTCTTCGTCAAG pLKO_005 159 CDS 100% 4.050 2.835 N Clic4 n/a
9 TRCN0000044360 GCATATAGTGATGTAGCCAAA pLKO.1 834 CDS 100% 4.050 2.835 N CLIC4 n/a
10 TRCN0000331702 GCATATAGTGATGTAGCCAAA pLKO_005 834 CDS 100% 4.050 2.835 N CLIC4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_013943.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02887 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02887 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000467619 TCGGATACGTCCCCTCTCCCCCCT pLX_317 60% 100% 100% V5 n/a
Download CSV