Transcript: Human NM_013958.3

Homo sapiens neuregulin 1 (NRG1), transcript variant HRG-beta3, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
NRG1 (3084)
Length:
1740
CDS:
518..1243

Additional Resources:

NCBI RefSeq record:
NM_013958.3
NBCI Gene record:
NRG1 (3084)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_013958.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000058303 CGTGGAATCAAACGAGATCAT pLKO.1 904 CDS 100% 4.950 6.930 N NRG1 n/a
2 TRCN0000416939 GGCTGATTCTGGAGAGTATAT pLKO_005 829 CDS 100% 13.200 9.240 N NRG1 n/a
3 TRCN0000058305 GCCTCAACTGAAGGAGCATAT pLKO.1 938 CDS 100% 10.800 7.560 N NRG1 n/a
4 TRCN0000058304 CGGTGTGAAACCAGTTCTGAA pLKO.1 683 CDS 100% 4.950 3.465 N NRG1 n/a
5 TRCN0000058307 TCATGGTGAAAGACCTTTCAA pLKO.1 1107 CDS 100% 0.563 0.394 N NRG1 n/a
6 TRCN0000444018 GACAGTGCCTCTGCCAATATC pLKO_005 878 CDS 100% 13.200 7.920 N NRG1 n/a
7 TRCN0000058306 CCACAGAAGGAGCAAATACTT pLKO.1 993 CDS 100% 5.625 3.375 N NRG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_013958.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15442 pDONR223 0% 99.8% 99.5% None 113G>A n/a
2 ccsbBroad304_15442 pLX_304 0% 99.8% 99.5% V5 113G>A n/a
3 TRCN0000474665 AGGGGATGGAGGTTCGACCCTCTC pLX_317 66.2% 99.8% 99.5% V5 113G>A n/a
Download CSV