Transcript: Human NM_014145.4

Homo sapiens transmembrane protein 230 (TMEM230), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-07-23
Taxon:
Homo sapiens (human)
Gene:
TMEM230 (29058)
Length:
1699
CDS:
374..736

Additional Resources:

NCBI RefSeq record:
NM_014145.4
NBCI Gene record:
TMEM230 (29058)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_014145.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000275146 CCCTCCTAAGATCCCTTATAA pLKO_005 484 CDS 100% 15.000 10.500 N TMEM230 n/a
2 TRCN0000275147 GAACCTACAGTTAGCTAATTA pLKO_005 893 3UTR 100% 15.000 10.500 N TMEM230 n/a
3 TRCN0000130398 GATGACATTCCAGACTTTGAT pLKO.1 710 CDS 100% 5.625 3.938 N TMEM230 n/a
4 TRCN0000275095 GATGACATTCCAGACTTTGAT pLKO_005 710 CDS 100% 5.625 3.938 N TMEM230 n/a
5 TRCN0000129581 CCAGTGCTGATCATTGGCATT pLKO.1 614 CDS 100% 4.050 2.835 N TMEM230 n/a
6 TRCN0000127789 GATCATTGGCATTCTGGTGTT pLKO.1 622 CDS 100% 4.050 2.835 N TMEM230 n/a
7 TRCN0000275149 GATCATTGGCATTCTGGTGTT pLKO_005 622 CDS 100% 4.050 2.835 N TMEM230 n/a
8 TRCN0000130943 CATTGGCATTCTGGTGTTCCT pLKO.1 625 CDS 100% 2.640 1.848 N TMEM230 n/a
9 TRCN0000131231 GACGATGGCTACATTGACCTT pLKO.1 449 CDS 100% 2.640 1.848 N TMEM230 n/a
10 TRCN0000275096 GACGATGGCTACATTGACCTT pLKO_005 449 CDS 100% 2.640 1.848 N TMEM230 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_014145.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03066 pDONR223 100% 100% 100% None n/a
2 ccsbBroadEn_08101 pDONR223 100% 99.7% 99.1% None 356A>C n/a
3 ccsbBroad304_08101 pLX_304 0% 99.7% 99.1% V5 356A>C n/a
4 TRCN0000468750 GCGGACCAATCTGGGAATACGTAT pLX_317 100% 99.7% 99.1% V5 356A>C n/a
5 ccsbBroadEn_15802 pDONR223 0% 99.7% 100% None 117T>A n/a
6 ccsbBroad304_15802 pLX_304 0% 99.7% 100% V5 117T>A n/a
7 TRCN0000474148 ACACACTCTCCGAGCACACATGGC pLX_317 100% 99.4% 99.1% V5 56A>G;117T>A n/a
Download CSV