Transcript: Human NM_014187.4

Homo sapiens transmembrane protein 208 (TMEM208), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
TMEM208 (29100)
Length:
776
CDS:
90..611

Additional Resources:

NCBI RefSeq record:
NM_014187.4
NBCI Gene record:
TMEM208 (29100)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_014187.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000129222 CCTTAAGGATGTGATCCTACT pLKO.1 392 CDS 100% 4.050 5.670 N TMEM208 n/a
2 TRCN0000280869 CCTTAAGGATGTGATCCTACT pLKO_005 392 CDS 100% 4.050 5.670 N TMEM208 n/a
3 TRCN0000128735 CAGAGAGACTCTGAAGTTCTA pLKO.1 146 CDS 100% 4.950 3.465 N TMEM208 n/a
4 TRCN0000280937 CAGAGAGACTCTGAAGTTCTA pLKO_005 146 CDS 100% 4.950 3.465 N TMEM208 n/a
5 TRCN0000129411 GAAGTTCTACCTGCGGATCAT pLKO.1 158 CDS 100% 4.950 3.465 N TMEM208 n/a
6 TRCN0000280868 GAAGTTCTACCTGCGGATCAT pLKO_005 158 CDS 100% 4.950 3.465 N TMEM208 n/a
7 TRCN0000131191 GAGAACAGAGAGACTCTGAAG pLKO.1 141 CDS 100% 4.050 2.835 N TMEM208 n/a
8 TRCN0000130242 CATTTACTGCCTTGTGACGTT pLKO.1 194 CDS 100% 2.640 1.848 N TMEM208 n/a
9 TRCN0000297907 CATTTACTGCCTTGTGACGTT pLKO_005 194 CDS 100% 2.640 1.848 N TMEM208 n/a
10 TRCN0000130362 GAACAGAGAGACTCTGAAGTT pLKO.1 143 CDS 100% 4.950 2.970 N TMEM208 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_014187.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03079 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03079 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000469023 ACAACACGCAATGAAGCTTCATCG pLX_317 73.2% 100% 100% V5 n/a
4 ccsbBroadEn_08112 pDONR223 100% 99.8% 99.4% None 244G>T n/a
5 ccsbBroad304_08112 pLX_304 0% 99.8% 99.4% V5 244G>T n/a
6 TRCN0000475367 AGGGCCACCATGGAACCACCTTTA pLX_317 30.4% 99.8% 99.4% V5 244G>T n/a
7 ccsbBroadEn_11898 pDONR223 100% 57.8% 57.8% None 301_519del n/a
8 ccsbBroad304_11898 pLX_304 0% 57.8% 57.8% V5 301_519del n/a
9 TRCN0000475070 TAAATAGTGGTCGTTCTTAACGTT pLX_317 95.6% 57.8% 57.8% V5 301_519del n/a
Download CSV