Transcript: Human NM_014245.5

Homo sapiens ring finger protein 7 (RNF7), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
RNF7 (9616)
Length:
2669
CDS:
45..386

Additional Resources:

NCBI RefSeq record:
NM_014245.5
NBCI Gene record:
RNF7 (9616)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_014245.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000295978 TCAGAAATTCTCTGCGATTAA pLKO_005 562 3UTR 100% 13.200 18.480 N RNF7 n/a
2 TRCN0000295934 TGCTTATGGTTGATCAGTTAA pLKO_005 747 3UTR 100% 13.200 18.480 N RNF7 n/a
3 TRCN0000243750 CAAGTCGGGAGGCGACAAGAT pLKO_005 110 CDS 100% 1.650 2.310 N LOC632465 n/a
4 TRCN0000038804 CCCAACTCTTACTCTTAATTT pLKO.1 807 3UTR 100% 15.000 12.000 N RNF7 n/a
5 TRCN0000038807 GTCTTAGATGTCAAGCTGAAA pLKO.1 226 CDS 100% 4.950 3.960 N RNF7 n/a
6 TRCN0000295935 ACAGCTTAGAAGTGCTATAAA pLKO_005 637 3UTR 100% 15.000 10.500 N RNF7 n/a
7 TRCN0000295933 GTAATCCAGTGCCCTACAAAG pLKO_005 438 3UTR 100% 10.800 7.560 N RNF7 n/a
8 TRCN0000239804 TGTGGGTGAAACAGAACAATC pLKO_005 316 CDS 100% 10.800 7.560 N LOC639931 n/a
9 TRCN0000307365 ATGTCCCTGTGGGTGAAACAG pLKO_005 309 CDS 100% 4.950 3.465 N Rnf7 n/a
10 TRCN0000239948 CATGTCCCTGTGGGTGAAACA pLKO_005 308 CDS 100% 4.950 3.465 N Gm7075 n/a
11 TRCN0000038806 CCTGTGGGTGAAACAGAACAA pLKO.1 314 CDS 100% 4.950 3.465 N RNF7 n/a
12 TRCN0000298777 CCTGTGGGTGAAACAGAACAA pLKO_005 314 CDS 100% 4.950 3.465 N RNF7 n/a
13 TRCN0000038805 CGACAAGATGTTCTCCCTCAA pLKO.1 122 CDS 100% 4.050 2.835 N RNF7 n/a
14 TRCN0000038808 CCTCAAGAAGTGGAACGCGGT pLKO.1 137 CDS 100% 0.180 0.126 N RNF7 n/a
15 TRCN0000239947 TGGTCCAAAGAATCGGCAAAT pLKO_005 364 CDS 100% 10.800 6.480 N Gm7075 n/a
16 TRCN0000243749 TCAAGAAGTGGAACGCGGTAG pLKO_005 139 CDS 100% 2.250 1.575 N LOC632465 n/a
17 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 1343 3UTR 100% 5.625 2.813 Y KLHL30 n/a
18 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 1343 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_014245.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02212 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02212 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000469857 AGATTTCGTTCTTTTGATTCATAA pLX_317 100% 100% 100% V5 n/a
4 ccsbBroadEn_07450 pDONR223 100% 99.4% 99.1% None 43T>C;114G>C n/a
5 ccsbBroad304_07450 pLX_304 0% 99.4% 99.1% V5 43T>C;114G>C n/a
Download CSV