Transcript: Human NM_014267.6

Homo sapiens chromosome 11 open reading frame 58 (C11orf58), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
C11orf58 (10944)
Length:
3920
CDS:
133..684

Additional Resources:

NCBI RefSeq record:
NM_014267.6
NBCI Gene record:
C11orf58 (10944)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_014267.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000130986 CAGGAAGATATCGGCGACATT pLKO.1 410 CDS 100% 4.950 6.930 N C11orf58 n/a
2 TRCN0000127965 GCTGCCAGTCACAATCTAAAT pLKO.1 1114 3UTR 100% 13.200 9.240 N C11orf58 n/a
3 TRCN0000292284 GCTGCCAGTCACAATCTAAAT pLKO_005 1114 3UTR 100% 13.200 9.240 N C11orf58 n/a
4 TRCN0000266845 TTGTTATAGGAGATCACAAAT pLKO_005 299 CDS 100% 13.200 9.240 N 1110004F10Rik n/a
5 TRCN0000129752 CAGATGATTCTGAAAGCGATT pLKO.1 530 CDS 100% 4.050 2.835 N C11orf58 n/a
6 TRCN0000130736 GACGATGATGATTCACCTGAT pLKO.1 499 CDS 100% 4.050 2.835 N C11orf58 n/a
7 TRCN0000292209 GACGATGATGATTCACCTGAT pLKO_005 499 CDS 100% 4.050 2.835 N C11orf58 n/a
8 TRCN0000130757 GCTTTCAAATGCCATGGGTTA pLKO.1 819 3UTR 100% 4.050 2.835 N C11orf58 n/a
9 TRCN0000292212 GCTTTCAAATGCCATGGGTTA pLKO_005 819 3UTR 100% 4.050 2.835 N C11orf58 n/a
10 TRCN0000128324 GCAGGAAAGAAAGAACATACT pLKO.1 271 CDS 100% 4.950 2.970 N C11orf58 n/a
11 TRCN0000292268 GCAGGAAAGAAAGAACATACT pLKO_005 271 CDS 100% 4.950 2.970 N C11orf58 n/a
12 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2106 3UTR 100% 5.625 2.813 Y KLHL30 n/a
13 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2106 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_014267.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02567 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02567 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000470050 GCGGTGGTACATGGCCCCTTATCG pLX_317 81.5% 100% 100% V5 n/a
Download CSV