Transcript: Human NM_014308.3

Homo sapiens phosphoinositide-3-kinase regulatory subunit 5 (PIK3R5), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
PIK3R5 (23533)
Length:
4449
CDS:
68..2710

Additional Resources:

NCBI RefSeq record:
NM_014308.3
NBCI Gene record:
PIK3R5 (23533)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_014308.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000195068 CCTCTAACACTACAGATTATT pLKO.1 2243 CDS 100% 15.000 21.000 N PIK3R5 n/a
2 TRCN0000362372 CCTCTAACACTACAGATTATT pLKO_005 2243 CDS 100% 15.000 21.000 N Pik3r5 n/a
3 TRCN0000195514 CCCTTACTTTGCCAAAGACTT pLKO.1 3090 3UTR 100% 4.950 6.930 N PIK3R5 n/a
4 TRCN0000304058 CCCTTACTTTGCCAAAGACTT pLKO_005 3090 3UTR 100% 4.950 6.930 N PIK3R5 n/a
5 TRCN0000195530 CCTGACCATTAGCATGGTCTA pLKO.1 2985 3UTR 100% 0.405 0.567 N PIK3R5 n/a
6 TRCN0000033271 CAGGATCTATAAACTCTTCAA pLKO.1 1333 CDS 100% 4.950 3.960 N PIK3R5 n/a
7 TRCN0000300371 CAGGATCTATAAACTCTTCAA pLKO_005 1333 CDS 100% 4.950 3.960 N PIK3R5 n/a
8 TRCN0000033273 CTGACGCTAAACCTGACAGAA pLKO.1 2384 CDS 100% 4.950 3.960 N PIK3R5 n/a
9 TRCN0000199372 CGCCATCTGCTGACTTCCTTT pLKO.1 1184 CDS 100% 4.950 3.465 N PIK3R5 n/a
10 TRCN0000033272 CTGTAGCCAATAAGCTGAGTA pLKO.1 597 CDS 100% 4.950 3.465 N PIK3R5 n/a
11 TRCN0000300448 CTGTAGCCAATAAGCTGAGTA pLKO_005 597 CDS 100% 4.950 3.465 N PIK3R5 n/a
12 TRCN0000033269 GCAGAACTCCAAATCCAAGAA pLKO.1 2416 CDS 100% 4.950 3.465 N PIK3R5 n/a
13 TRCN0000300450 GCAGAACTCCAAATCCAAGAA pLKO_005 2416 CDS 100% 4.950 3.465 N PIK3R5 n/a
14 TRCN0000033270 CTCACCTTCATTGATGCTGAA pLKO.1 446 CDS 100% 4.050 2.835 N PIK3R5 n/a
15 TRCN0000195663 CTCTCTGTGGAGAACTGAATG pLKO.1 2780 3UTR 100% 10.800 6.480 N PIK3R5 n/a
16 TRCN0000304059 CTCTCTGTGGAGAACTGAATG pLKO_005 2780 3UTR 100% 10.800 6.480 N PIK3R5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_014308.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11743 pDONR223 100% 56.1% 1.4% None 1_1158del n/a
2 ccsbBroad304_11743 pLX_304 0% 56.1% 1.4% V5 (not translated due to prior stop codon) 1_1158del n/a
3 TRCN0000467349 AAGCTACCCACTACACCAGGGGTA pLX_317 24.9% 56.1% 1.4% V5 (not translated due to prior stop codon) 1_1158del n/a
4 ccsbBroadEn_15014 pDONR223 0% 56.1% 56.1% None 1_1158del n/a
5 ccsbBroad304_15014 pLX_304 0% 56.1% 56.1% V5 1_1158del n/a
6 TRCN0000472661 GTAGACTGAATAGGAGACAGGTTT pLX_317 24.4% 56.1% 56.1% V5 (not translated due to frame shift) 1_1158del n/a
Download CSV