Transcript: Human NM_014398.4

Homo sapiens lysosomal associated membrane protein 3 (LAMP3), mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
LAMP3 (27074)
Length:
3196
CDS:
80..1330

Additional Resources:

NCBI RefSeq record:
NM_014398.4
NBCI Gene record:
LAMP3 (27074)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_014398.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000147931 GTCAGTCAAGACTGGAATTTA pLKO.1 742 CDS 100% 15.000 10.500 N LAMP3 n/a
2 TRCN0000148784 CGTCAGTCAAGACTGGAATTT pLKO.1 741 CDS 100% 13.200 9.240 N LAMP3 n/a
3 TRCN0000129997 GATGGTCATATCACCTTTCAA pLKO.1 287 CDS 100% 5.625 3.938 N LAMP3 n/a
4 TRCN0000146973 CGGATTTGTGAATCTCACATT pLKO.1 940 CDS 100% 4.950 3.465 N LAMP3 n/a
5 TRCN0000129513 GCAGCAACAGTACAGGACATA pLKO.1 203 CDS 100% 4.950 3.465 N LAMP3 n/a
6 TRCN0000128156 CCTTGATCTTAACAAAGCCTT pLKO.1 1709 3UTR 100% 2.640 1.848 N LAMP3 n/a
7 TRCN0000130876 GTCTCAGATCCAGAGACAATT pLKO.1 1013 CDS 100% 1.320 0.924 N LAMP3 n/a
8 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2092 3UTR 100% 5.625 2.813 Y KLHL30 n/a
9 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2092 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_014398.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08051 pDONR223 100% 99.7% 99.5% None 95A>G;267G>A;952A>G n/a
2 ccsbBroad304_08051 pLX_304 0% 99.7% 99.5% V5 95A>G;267G>A;952A>G n/a
3 TRCN0000474798 AGTAAACGAACTCCATTACTATTG pLX_317 30.5% 99.7% 99.5% V5 95A>G;267G>A;952A>G n/a
Download CSV