Transcript: Human NM_014460.4

Homo sapiens cold shock domain containing C2 (CSDC2), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
CSDC2 (27254)
Length:
2530
CDS:
298..759

Additional Resources:

NCBI RefSeq record:
NM_014460.4
NBCI Gene record:
CSDC2 (27254)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_014460.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000019793 CGACGAGGTGACCTACAAGAT pLKO.1 627 CDS 100% 4.950 6.930 N CSDC2 n/a
2 TRCN0000019790 TCCGAGGACATCTTCGTACAT pLKO.1 568 CDS 100% 4.950 6.930 N CSDC2 n/a
3 TRCN0000019791 CCGTGTTCAAGGGCGTCTGTA pLKO.1 497 CDS 100% 1.650 2.310 N CSDC2 n/a
4 TRCN0000019789 GACCTACAAGATGTGCCCTAT pLKO.1 636 CDS 100% 4.050 2.835 N CSDC2 n/a
5 TRCN0000019792 TGTAAGCAGTTCTCACGCTCA pLKO.1 514 CDS 100% 2.160 1.512 N CSDC2 n/a
6 TRCN0000099733 GACGAGGTGACCTACAAGATT pLKO.1 628 CDS 100% 5.625 3.938 N Csdc2 n/a
7 TRCN0000166364 CACACACACACACACACACAA pLKO.1 38 5UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_014460.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03015 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03015 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000479547 CCCAATACTACGTTTTATTGCGAT pLX_317 58.6% 100% 100% V5 n/a
Download CSV