Transcript: Human NM_014470.4

Homo sapiens Rho family GTPase 1 (RND1), mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
RND1 (27289)
Length:
1653
CDS:
104..802

Additional Resources:

NCBI RefSeq record:
NM_014470.4
NBCI Gene record:
RND1 (27289)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_014470.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000047437 CCCTACTACGATAATGTCCGT pLKO.1 317 CDS 100% 0.660 0.924 N RND1 n/a
2 TRCN0000047435 GAGGACAGAAATCCTAGATTA pLKO.1 424 CDS 100% 13.200 9.240 N RND1 n/a
3 TRCN0000047434 GCTCTGAACTCATCTCTTCTA pLKO.1 741 CDS 100% 4.950 3.465 N RND1 n/a
4 TRCN0000047433 TGGAGCTTAGTCTCTGGGATA pLKO.1 285 CDS 100% 4.050 2.835 N RND1 n/a
5 TRCN0000047436 CCATCTCCTATGAGCAGGGTT pLKO.1 540 CDS 100% 2.640 1.848 N RND1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_014470.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03017 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03017 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000465571 TGTAGCCATAGAGGTGAGCAAAGG pLX_317 36.7% 100% 100% V5 n/a
Download CSV