Transcript: Human NM_014570.5

Homo sapiens ADP ribosylation factor GTPase activating protein 3 (ARFGAP3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
ARFGAP3 (26286)
Length:
2728
CDS:
92..1642

Additional Resources:

NCBI RefSeq record:
NM_014570.5
NBCI Gene record:
ARFGAP3 (26286)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_014570.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000047337 GCCAAGGTGGTATCTAAAGAA pLKO.1 875 CDS 100% 5.625 4.500 N ARFGAP3 n/a
2 TRCN0000307677 GCCAAGGTGGTATCTAAAGAA pLKO_005 875 CDS 100% 5.625 4.500 N ARFGAP3 n/a
3 TRCN0000047333 GCCCACTAACAAGGTGTGTTT pLKO.1 148 CDS 100% 4.950 3.960 N ARFGAP3 n/a
4 TRCN0000047336 GCACTGATCTGTGGCTTGATA pLKO.1 477 CDS 100% 5.625 3.938 N ARFGAP3 n/a
5 TRCN0000291341 GCACTGATCTGTGGCTTGATA pLKO_005 477 CDS 100% 5.625 3.938 N ARFGAP3 n/a
6 TRCN0000047334 CCAGATTATGAGCCAGTTGAA pLKO.1 1307 CDS 100% 4.950 3.465 N ARFGAP3 n/a
7 TRCN0000291342 CCAGATTATGAGCCAGTTGAA pLKO_005 1307 CDS 100% 4.950 3.465 N ARFGAP3 n/a
8 TRCN0000047335 GCTGGGATGACAGTTCAGATT pLKO.1 1200 CDS 100% 4.950 3.465 N ARFGAP3 n/a
9 TRCN0000291340 GCTGGGATGACAGTTCAGATT pLKO_005 1200 CDS 100% 4.950 3.465 N ARFGAP3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_014570.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08012 pDONR223 100% 99.8% 99.8% None 1065T>G;1353G>A;1431T>C n/a
2 ccsbBroad304_08012 pLX_304 0% 99.8% 99.8% V5 1065T>G;1353G>A;1431T>C n/a
3 TRCN0000472685 AGATATCTTATCCCTGGCAACTAA pLX_317 20.7% 99.8% 99.8% V5 1065T>G;1353G>A;1431T>C n/a
Download CSV