Transcript: Human NM_014625.4

Homo sapiens NPHS2 stomatin family member, podocin (NPHS2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-31
Taxon:
Homo sapiens (human)
Gene:
NPHS2 (7827)
Length:
1870
CDS:
85..1236

Additional Resources:

NCBI RefSeq record:
NM_014625.4
NBCI Gene record:
NPHS2 (7827)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_014625.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000429504 TCGTGACCAAAGACATGTTTA pLKO_005 620 CDS 100% 13.200 18.480 N NPHS2 n/a
2 TRCN0000118890 TGTATCTAAAGCTGTGCAATT pLKO.1 711 CDS 100% 10.800 15.120 N NPHS2 n/a
3 TRCN0000118887 CCAATGATACTACCAAGTCTT pLKO.1 1682 3UTR 100% 4.950 6.930 N NPHS2 n/a
4 TRCN0000432744 TGAGTCTAGATGTGGTTAAAT pLKO_005 1503 3UTR 100% 15.000 12.000 N NPHS2 n/a
5 TRCN0000118891 CAAACCTGTTGAGCCACTAAA pLKO.1 1185 CDS 100% 13.200 9.240 N NPHS2 n/a
6 TRCN0000416737 TTCCATCTGGTTCTGCGTAAA pLKO_005 441 CDS 100% 10.800 7.560 N NPHS2 n/a
7 TRCN0000118889 CAAGCCAAAGTGCGGATGATT pLKO.1 943 CDS 100% 5.625 3.938 N NPHS2 n/a
8 TRCN0000118888 CCTTGTGCAAACCACTATGAA pLKO.1 732 CDS 100% 5.625 3.938 N NPHS2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_014625.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11243 pDONR223 100% 81.9% 82.2% None (many diffs) n/a
2 ccsbBroadEn_14885 pDONR223 91.8% 81.9% 82.2% None (many diffs) n/a
3 ccsbBroad304_14885 pLX_304 0% 81.9% 82.2% V5 (many diffs) n/a
4 TRCN0000470834 GATGCGCTGATTGAGACCACCGAA pLX_317 49% 81.9% 82.2% V5 (many diffs) n/a
Download CSV