Transcript: Human NM_014662.5

Homo sapiens DEP domain containing 5, GATOR1 subcomplex subunit (DEPDC5), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-31
Taxon:
Homo sapiens (human)
Gene:
DEPDC5 (9681)
Length:
5326
CDS:
90..4808

Additional Resources:

NCBI RefSeq record:
NM_014662.5
NBCI Gene record:
DEPDC5 (9681)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_014662.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000137523 GACCTTCATCTACGGCTTCTA pLKO.1 3743 CDS 100% 4.950 6.930 N DEPDC5 n/a
2 TRCN0000137028 CCAAATCATAGTGCAGCCCAA pLKO.1 2495 CDS 100% 2.160 3.024 N DEPDC5 n/a
3 TRCN0000134778 CCATTGTTCAAGCTCCATAAT pLKO.1 1221 CDS 100% 13.200 10.560 N DEPDC5 n/a
4 TRCN0000135857 CCCTTGACCTAGTGGAATTAA pLKO.1 376 CDS 100% 15.000 10.500 N DEPDC5 n/a
5 TRCN0000136459 CCTTCACCATCTATGGGATAT pLKO.1 5168 3UTR 100% 10.800 7.560 N DEPDC5 n/a
6 TRCN0000135505 GCTTCTTGTTAGTCCCAGTTT pLKO.1 4234 CDS 100% 4.950 3.465 N DEPDC5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_014662.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02226 pDONR223 100% 35.4% 35.3% None 1668_1670delTGTinsGCA;1673_1674insA;1677_4716del n/a
2 ccsbBroad304_02226 pLX_304 0% 35.4% 35.3% V5 1668_1670delTGTinsGCA;1673_1674insA;1677_4716del n/a
3 TRCN0000471584 ACGCCCCGTCACTGCACAAAGTGG pLX_317 23.1% 35.4% 35.3% V5 1668_1670delTGTinsGCA;1673_1674insA;1677_4716del n/a
Download CSV