Construct: ORF TRCN0000471584
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF015078.1_s317c1
- Derived from:
- ccsbBroadEn_02226
- DNA Barcode:
- ACGCCCCGTCACTGCACAAAGTGG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- DEPDC5 (9681)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000471584
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 9681 | DEPDC5 | DEP domain containing 5, GA... | NM_001007188.3 | 100% | 100% | |
| 2 | human | 9681 | DEPDC5 | DEP domain containing 5, GA... | XM_017029115.1 | 85.8% | 85.6% | 1668_1670delTGTinsGCA;1673_1674insA;1677_1947del |
| 3 | human | 9681 | DEPDC5 | DEP domain containing 5, GA... | XM_017029114.1 | 77.8% | 77.6% | 1668_1670delTGTinsGCA;1673_1674insA;1677_2148del |
| 4 | human | 9681 | DEPDC5 | DEP domain containing 5, GA... | XM_017029113.1 | 76.6% | 76.4% | 1668_1670delTGTinsGCA;1673_1674insA;1677_2181del |
| 5 | human | 9681 | DEPDC5 | DEP domain containing 5, GA... | XM_011530568.2 | 47.4% | 47.2% | 1668_1670delTGTinsGCA;1673_1674insA;1677_3528del |
| 6 | human | 9681 | DEPDC5 | DEP domain containing 5, GA... | XM_011530565.2 | 42.6% | 42.5% | 1668_1670delTGTinsGCA;1673_1674insA;1677_3921del |
| 7 | human | 9681 | DEPDC5 | DEP domain containing 5, GA... | NM_001242897.2 | 37% | 36.9% | 1668_1670delTGTinsGCA;1673_1674insA;1677_4509del |
| 8 | human | 9681 | DEPDC5 | DEP domain containing 5, GA... | XM_011530563.2 | 37% | 36.9% | 1668_1670delTGTinsGCA;1673_1674insA;1677_4509del |
| 9 | human | 9681 | DEPDC5 | DEP domain containing 5, GA... | XM_011530562.2 | 36.8% | 36.6% | 1668_1670delTGTinsGCA;1673_1674insA;1677_4545del |
| 10 | human | 9681 | DEPDC5 | DEP domain containing 5, GA... | XM_011530561.2 | 36.7% | 36.6% | 1668_1670delTGTinsGCA;1673_1674insA;1677_4548del |
| 11 | human | 9681 | DEPDC5 | DEP domain containing 5, GA... | NM_001363854.2 | 36.5% | 36.4% | 1668_1670delTGTinsGCA;1673_1674insA;1677_4575del |
| 12 | human | 9681 | DEPDC5 | DEP domain containing 5, GA... | NM_001364319.1 | 36.5% | 36.4% | 1668_1670delTGTinsGCA;1673_1674insA;1677_4575del |
| 13 | human | 9681 | DEPDC5 | DEP domain containing 5, GA... | NM_001369903.1 | 35.4% | 35.3% | 1668_1670delTGTinsGCA;1673_1674insA;1677_4716del |
| 14 | human | 9681 | DEPDC5 | DEP domain containing 5, GA... | NM_014662.5 | 35.4% | 35.3% | 1668_1670delTGTinsGCA;1673_1674insA;1677_4716del |
| 15 | human | 9681 | DEPDC5 | DEP domain containing 5, GA... | NM_001363852.2 | 35.2% | 35.1% | 1668_1670delTGTinsGCA;1673_1674insA;1677_4743del |
| 16 | human | 9681 | DEPDC5 | DEP domain containing 5, GA... | NM_001364320.1 | 35.2% | 35.1% | 1668_1670delTGTinsGCA;1673_1674insA;1677_4743del |
| 17 | human | 9681 | DEPDC5 | DEP domain containing 5, GA... | NM_001136029.3 | 34.9% | 34.8% | 1668_1670delTGTinsGCA;1673_1674insA;1677_4782del |
| 18 | human | 9681 | DEPDC5 | DEP domain containing 5, GA... | XM_011530557.2 | 34.9% | 34.8% | 1668_1670delTGTinsGCA;1673_1674insA;1677_4782del |
| 19 | human | 9681 | DEPDC5 | DEP domain containing 5, GA... | NM_001242896.3 | 34.7% | 34.6% | 1668_1670delTGTinsGCA;1673_1674insA;1677_4809del |
| 20 | human | 9681 | DEPDC5 | DEP domain containing 5, GA... | NM_001364318.1 | 34.7% | 34.6% | 1668_1670delTGTinsGCA;1673_1674insA;1677_4809del |
| 21 | human | 9681 | DEPDC5 | DEP domain containing 5, GA... | NM_001369901.1 | 33% | 32.9% | (many diffs) |
| 22 | human | 9681 | DEPDC5 | DEP domain containing 5, GA... | NM_001369902.1 | 33% | 32.9% | (many diffs) |
| 23 | human | 9681 | DEPDC5 | DEP domain containing 5, GA... | NR_157126.1 | 32.8% | (many diffs) | |
| 24 | human | 9681 | DEPDC5 | DEP domain containing 5, GA... | NR_110988.2 | 32.6% | (many diffs) | |
| 25 | human | 9681 | DEPDC5 | DEP domain containing 5, GA... | XR_937973.2 | 32.3% | (many diffs) | |
| 26 | human | 9681 | DEPDC5 | DEP domain containing 5, GA... | NR_157125.1 | 31.8% | (many diffs) | |
| 27 | human | 9681 | DEPDC5 | DEP domain containing 5, GA... | NR_157128.1 | 31.2% | (many diffs) | |
| 28 | human | 9681 | DEPDC5 | DEP domain containing 5, GA... | NR_146296.2 | 30.4% | (many diffs) | |
| 29 | human | 9681 | DEPDC5 | DEP domain containing 5, GA... | XR_001755390.1 | 29.8% | (many diffs) | |
| 30 | human | 9681 | DEPDC5 | DEP domain containing 5, GA... | XR_001755389.1 | 27.2% | (many diffs) | |
| 31 | mouse | 277854 | Depdc5 | DEP domain containing 5 | NM_177786.4 | 47.3% | 49.6% | (many diffs) |
| 32 | mouse | 277854 | Depdc5 | DEP domain containing 5 | XM_017320910.1 | 45.4% | 47.6% | (many diffs) |
| 33 | mouse | 277854 | Depdc5 | DEP domain containing 5 | NM_001025426.2 | 33.5% | 35.2% | (many diffs) |
| 34 | mouse | 277854 | Depdc5 | DEP domain containing 5 | XM_006503987.3 | 32.7% | 34.3% | (many diffs) |
| 35 | mouse | 277854 | Depdc5 | DEP domain containing 5 | XM_006503985.3 | 32.5% | 34.1% | (many diffs) |
| 36 | mouse | 277854 | Depdc5 | DEP domain containing 5 | XM_006503986.3 | 32.5% | 34.1% | (many diffs) |
| 37 | mouse | 277854 | Depdc5 | DEP domain containing 5 | NM_001170567.1 | 32.2% | 33.8% | (many diffs) |
| 38 | mouse | 277854 | Depdc5 | DEP domain containing 5 | XM_006503984.3 | 32.2% | 33.8% | (many diffs) |
| 39 | mouse | 277854 | Depdc5 | DEP domain containing 5 | XM_006503978.3 | 32.1% | 33.6% | (many diffs) |
| 40 | mouse | 277854 | Depdc5 | DEP domain containing 5 | XM_006503979.3 | 32.1% | 33.6% | (many diffs) |
| 41 | mouse | 277854 | Depdc5 | DEP domain containing 5 | XM_006503980.3 | 32.1% | 33.6% | (many diffs) |
| 42 | mouse | 277854 | Depdc5 | DEP domain containing 5 | XM_006503981.3 | 32.1% | 33.6% | (many diffs) |
| 43 | mouse | 277854 | Depdc5 | DEP domain containing 5 | XM_006503982.3 | 32.1% | 33.6% | (many diffs) |
| 44 | mouse | 277854 | Depdc5 | DEP domain containing 5 | XM_006503983.3 | 32.1% | 33.6% | (many diffs) |
| 45 | mouse | 277854 | Depdc5 | DEP domain containing 5 | XM_017320908.1 | 32.1% | 33.6% | (many diffs) |
| 46 | mouse | 277854 | Depdc5 | DEP domain containing 5 | XM_006503989.3 | 22.7% | 23.6% | (many diffs) |
| 47 | mouse | 277854 | Depdc5 | DEP domain containing 5 | XM_006503988.3 | 22.3% | 23.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1743
- ORF length:
- 1677
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgag aacaacaaag gtctacaaac tcgtcatcca caagaagggc tttgggggca 121 gtgatgatga gctagttgtg aaccccaaag tgttccctca catcaagctt ggagacattg 181 tagagattgc acaccccaac gatgaataca gccctctgct tttgcaggtc aagtctctta 241 aggaagattt acagaaggaa actatcagtg tggaccagac tgtgactcaa gtgttccggc 301 tgagacctta tcaggatgtc tatgttaatg tcgtagaccc taaggatgtg acccttgacc 361 tagtggaatt aacttttaag gatcagtata ttggccgtgg ggatatgtgg cgactaaaga 421 aaagtttggt cagcacatgt gcctatatca cccagaaggt ggagtttgct ggcatcagag 481 cacaggctgg tgaactgtgg gttaagaatg agaaggtcat gtgtggctac atcagtgaag 541 ataccagggt ggtgtttcgt tctacgtcgg ctatggttta catatttatt cagatgagct 601 gtgaaatgtg ggattttgat atttatgggg atttgtattt tgagaaagct gtgaatggtt 661 tccttgctga tctatttacc aagtggaagg agaagaactg tagtcatgaa gtgacagtgg 721 tcctgttttc tagaactttc tatgatgcaa aatctgttga tgaatttcct gaaataaacc 781 gagcctcaat tcgacaggat cacaagggga gattctatga agacttttac aaagtggtgg 841 tgcagaatga gagaagagaa gaatggactt cacttctcgt aaccattaaa aaactcttca 901 tccagtatcc agtgttggtg cgactggaac aggcagaggg ctttcctcaa ggagataatt 961 ctacctcagc acaaggaaac tacctggagg ccatcaatct gtcattcaat gtgtttgata 1021 agcactacat caaccgcaac tttgaccgaa ctgggcagat gtcagtggtg atcacgcccg 1081 gggtgggtgt ctttgaagtg gaccgcctac tcatgatcct gaccaagcag cggatgatag 1141 ataatggaat tggtgtggat ttggtgtgca tgggagagca accgttacat gctgtcccat 1201 tgttcaagct ccataatcgg agtgctcccc gtgattctcg tctgggcgat gactataata 1261 tccctcactg gataaaccac agtttctaca catccaaaag ccagctcttt tgtaatagtt 1321 tcaccccacg aataaaactg gcaggaaaga agcccgcctc TGAGAAAGCA AAAAATGGCC 1381 GTGATACATC TCTCGGGAGT CCAAAAGAAT CTGAGAACGC CCTTCCCATC CAAGTAGATT 1441 ATGACGCCTA TGACGCTCAA GTGTTCAGGC TGCCCGGCCC ATCCCGGGCC CAGTGCCTCA 1501 CCACCTGCAG ATCTGTGCGA GAGCGAGAGA GTCACAGTCG AAAGAGTGCC AGCTCCTGTG 1561 ATGTTTCATC CAGCCCTTCC CTACCAAGCC GCACACTGCC CACTGAGGAA GTGAGGAGCC 1621 AGGCTTCTGA CGACAGCTCC CTAGGCAAGA GTGCCAACAT CCTGATGATC CCACACCCCC 1681 ACCTGCACCA GTATGAAGTC AGCAGCTCCT TGGGATACAC CAGCACTCGA GAGCACCTAG 1741 GATACCCAAC TTTCTTGTAC AAAGTGGTTG ATATCGGTAA GCCTATCCCT AACCCTCTCC 1801 TCGGTCTCGA TTCTACGTAG TAATGAACTA GTCCGTAACT TGAAAGTATT TCGATTTCTT 1861 GGCTTTATAT ATCTTGTGGA AAGGACGAAC GCCCCGTCAC TGCACAAAGT GGACGCGTTA 1921 AGTCgacaat caacctctgg attacaaaat ttgtgaaaga tt