Transcript: Human NM_014676.3

Homo sapiens pumilio RNA binding family member 1 (PUM1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
PUM1 (9698)
Length:
5379
CDS:
114..3674

Additional Resources:

NCBI RefSeq record:
NM_014676.3
NBCI Gene record:
PUM1 (9698)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_014676.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000275489 GCGTTTAAGGGACAGGTATTT pLKO_005 3087 CDS 100% 13.200 18.480 N PUM1 n/a
2 TRCN0000148785 CAGTTCTTTCTACGGCAACAA pLKO.1 2039 CDS 100% 4.950 6.930 N PUM1 n/a
3 TRCN0000147347 GCAGCAACTAATTCAGCTAAT pLKO.1 1560 CDS 100% 10.800 8.640 N PUM1 n/a
4 TRCN0000275487 GCAGCAACTAATTCAGCTAAT pLKO_005 1560 CDS 100% 10.800 8.640 N PUM1 n/a
5 TRCN0000102253 CCTGCTGCTTACTATGACCAA pLKO.1 1776 CDS 100% 2.640 2.112 N Pum1 n/a
6 TRCN0000287246 CCTGCTGCTTACTATGACCAA pLKO_005 1776 CDS 100% 2.640 2.112 N Pum1 n/a
7 TRCN0000275486 TACATGGGAGGCCACATATTT pLKO_005 3948 3UTR 100% 15.000 10.500 N PUM1 n/a
8 TRCN0000146945 CCAGCTTGTCTTCAATGAAAT pLKO.1 2747 CDS 100% 13.200 9.240 N PUM1 n/a
9 TRCN0000285399 CCAGCTTGTCTTCAATGAAAT pLKO_005 2747 CDS 100% 13.200 9.240 N PUM1 n/a
10 TRCN0000275488 CTGACCAGACACTCCCTATTT pLKO_005 3169 CDS 100% 13.200 9.240 N PUM1 n/a
11 TRCN0000148491 CCTCACCAGTATTATGGAGTT pLKO.1 1482 CDS 100% 4.050 2.835 N PUM1 n/a
12 TRCN0000148263 GTGACCTTTATAAGAGGACAT pLKO.1 2254 CDS 100% 4.050 2.835 N PUM1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_014676.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07469 pDONR223 100% 99.9% 100% None 2337T>C n/a
2 ccsbBroad304_07469 pLX_304 0% 99.9% 100% V5 2337T>C n/a
Download CSV