Transcript: Human NM_014797.2

Homo sapiens zinc finger and BTB domain containing 24 (ZBTB24), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-07-02
Taxon:
Homo sapiens (human)
Gene:
ZBTB24 (9841)
Length:
5597
CDS:
169..2262

Additional Resources:

NCBI RefSeq record:
NM_014797.2
NBCI Gene record:
ZBTB24 (9841)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_014797.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000095542 GAAGCCATTTACTTGTGAAAT pLKO.1 1461 CDS 100% 13.200 9.240 N Zbtb24 n/a
2 TRCN0000107435 GCAGTGTTTCACAATTCATTT pLKO.1 5200 3UTR 100% 13.200 9.240 N ZBTB24 n/a
3 TRCN0000107437 CCAGTAGTGAATACTTCTCAA pLKO.1 338 CDS 100% 4.950 3.465 N ZBTB24 n/a
4 TRCN0000107436 CCTGAGTGTAACTTACAGTTT pLKO.1 1645 CDS 100% 4.950 3.465 N ZBTB24 n/a
5 TRCN0000107438 GCAGCATTTCTGGCAGTAGTA pLKO.1 1733 CDS 100% 4.950 3.465 N ZBTB24 n/a
6 TRCN0000107439 CCTCTGTGACATTACTTTAAT pLKO.1 273 CDS 100% 15.000 9.000 N ZBTB24 n/a
7 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 4849 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_014797.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02258 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02258 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000480386 GATGCATTTGGTTTGTCTGCCCTC pLX_317 19.3% 100% 100% V5 n/a
4 ccsbBroadEn_02257 pDONR223 100% 46.7% 45.5% None (many diffs) n/a
5 ccsbBroad304_02257 pLX_304 0% 46.7% 45.5% V5 (many diffs) n/a
6 TRCN0000465234 CATACCCCGGGCCCCCAGCACACC pLX_317 28.4% 46.7% 45.5% V5 (many diffs) n/a
Download CSV