Transcript: Human NM_014844.5

Homo sapiens tectonin beta-propeller repeat containing 2 (TECPR2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
TECPR2 (9895)
Length:
8704
CDS:
249..4484

Additional Resources:

NCBI RefSeq record:
NM_014844.5
NBCI Gene record:
TECPR2 (9895)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_014844.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000263380 GAGGACGAGTCTACTAATTAT pLKO_005 5522 3UTR 100% 15.000 21.000 N TECPR2 n/a
2 TRCN0000263378 TTGACCAGTGCAGCTTATTTC pLKO_005 3349 CDS 100% 13.200 18.480 N TECPR2 n/a
3 TRCN0000282593 CCATTGTGCAGCTGGATTATA pLKO_005 769 CDS 100% 15.000 10.500 N TECPR2 n/a
4 TRCN0000263379 GCAGTAGCGTGGATCAGTTAA pLKO_005 1786 CDS 100% 13.200 9.240 N TECPR2 n/a
5 TRCN0000167788 GCCTTTGTTGTTGTATTACAA pLKO.1 5544 3UTR 100% 5.625 3.938 N TECPR2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_014844.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07505 pDONR223 100% 89.5% 89.3% None (many diffs) n/a
2 ccsbBroad304_07505 pLX_304 0% 89.5% 89.3% V5 (many diffs) n/a
3 TRCN0000479288 TCATTCTCTCTTCACTTCGGGCGC pLX_317 10.4% 89.5% 89.3% V5 (many diffs) n/a
Download CSV