Transcript: Human NM_014878.5

Homo sapiens pumilio RNA binding family member 3 (PUM3), mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
PUM3 (9933)
Length:
2187
CDS:
62..2008

Additional Resources:

NCBI RefSeq record:
NM_014878.5
NBCI Gene record:
PUM3 (9933)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_014878.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000152661 GTGTAAATCGAGGTGCCATTA pLKO.1 1845 CDS 100% 10.800 15.120 N PUM3 n/a
2 TRCN0000280606 GTGTAAATCGAGGTGCCATTA pLKO_005 1845 CDS 100% 10.800 15.120 N PUM3 n/a
3 TRCN0000151226 GCGGCATTTGATTGTATTGAT pLKO.1 1277 CDS 100% 5.625 7.875 N PUM3 n/a
4 TRCN0000153187 GCGAGATGATTTGGTTGAGTT pLKO.1 667 CDS 100% 4.950 6.930 N PUM3 n/a
5 TRCN0000153663 CTGGCGGCATTTGATTGTATT pLKO.1 1274 CDS 100% 13.200 10.560 N PUM3 n/a
6 TRCN0000152764 GCACCAGCAAAGGAATAGAAA pLKO.1 1962 CDS 100% 5.625 4.500 N PUM3 n/a
7 TRCN0000280669 GCACCAGCAAAGGAATAGAAA pLKO_005 1962 CDS 100% 5.625 4.500 N PUM3 n/a
8 TRCN0000151133 GCCTAGCATAGTAAATGACAA pLKO.1 1348 CDS 100% 4.950 3.960 N PUM3 n/a
9 TRCN0000280605 GCCTAGCATAGTAAATGACAA pLKO_005 1348 CDS 100% 4.950 3.960 N PUM3 n/a
10 TRCN0000153825 CGTGTGATCCAGTGTTACATT pLKO.1 602 CDS 100% 5.625 3.938 N PUM3 n/a
11 TRCN0000280670 CGTGTGATCCAGTGTTACATT pLKO_005 602 CDS 100% 5.625 3.938 N PUM3 n/a
12 TRCN0000280663 TAAGAGCAAGATGGAATGATT pLKO_005 2020 3UTR 100% 5.625 3.938 N PUM3 n/a
13 TRCN0000152660 GAGCTTCACATTGCAGAACAT pLKO.1 1694 CDS 100% 4.950 3.465 N PUM3 n/a
14 TRCN0000152473 CGCATACAATGACAAAGCCAT pLKO.1 832 CDS 100% 2.640 1.848 N PUM3 n/a
15 TRCN0000152623 GCATGTTGGTATGAAGAACCT pLKO.1 1810 CDS 100% 2.640 1.848 N PUM3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_014878.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07512 pDONR223 100% 99.8% 99.5% None 38G>A;866G>C;889G>T n/a
2 ccsbBroad304_07512 pLX_304 0% 99.8% 99.5% V5 38G>A;866G>C;889G>T n/a
3 TRCN0000476623 ACACAACCGCCAGCAGCAAGTTGA pLX_317 20.2% 99.8% 99.5% V5 38G>A;866G>C;889G>T n/a
Download CSV