Transcript: Human NM_014929.3

Homo sapiens FAST kinase domains 2 (FASTKD2), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-04-13
Taxon:
Homo sapiens (human)
Gene:
FASTKD2 (22868)
Length:
6837
CDS:
318..2450

Additional Resources:

NCBI RefSeq record:
NM_014929.3
NBCI Gene record:
FASTKD2 (22868)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_014929.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000140752 GCCATGAATCACCGATCTCTT pLKO.1 1377 CDS 100% 4.950 6.930 N FASTKD2 n/a
2 TRCN0000352940 GCCATGAATCACCGATCTCTT pLKO_005 1377 CDS 100% 4.950 6.930 N FASTKD2 n/a
3 TRCN0000142538 GCTTTCGACCTGTTGGTTTAA pLKO.1 1606 CDS 100% 13.200 9.240 N FASTKD2 n/a
4 TRCN0000343559 GCTTTCGACCTGTTGGTTTAA pLKO_005 1606 CDS 100% 13.200 9.240 N FASTKD2 n/a
5 TRCN0000145126 GCTTTCAAACAAAGGGCATAA pLKO.1 583 CDS 100% 10.800 7.560 N FASTKD2 n/a
6 TRCN0000343506 GCTTTCAAACAAAGGGCATAA pLKO_005 583 CDS 100% 10.800 7.560 N FASTKD2 n/a
7 TRCN0000145537 CAAGTCAGTTGTCAATGGAAT pLKO.1 2510 3UTR 100% 4.950 3.465 N FASTKD2 n/a
8 TRCN0000144151 CCTTGTCTTTGGAATCTGAAT pLKO.1 2789 3UTR 100% 4.950 3.465 N FASTKD2 n/a
9 TRCN0000141433 CTTGGTCAATAACTGGGAGAT pLKO.1 2327 CDS 100% 4.050 2.835 N FASTKD2 n/a
10 TRCN0000140593 GCCCACATTTCCTAGTAGCAA pLKO.1 845 CDS 100% 3.000 2.100 N FASTKD2 n/a
11 TRCN0000145153 GCCCAGATATTTGATTTGTGA pLKO.1 2679 3UTR 100% 3.000 2.100 N FASTKD2 n/a
12 TRCN0000142162 GAGTGTGATGAGATATGCCTT pLKO.1 1107 CDS 100% 2.640 1.848 N FASTKD2 n/a
13 TRCN0000352879 GAGTGTGATGAGATATGCCTT pLKO_005 1107 CDS 100% 2.640 1.848 N FASTKD2 n/a
14 TRCN0000139448 CTCCTGCTCTAAGCTGTTCTA pLKO.1 2817 3UTR 100% 4.950 2.970 N FASTKD2 n/a
15 TRCN0000162795 CTTCCAAAGTGCTGGGATTAT pLKO.1 6136 3UTR 100% 13.200 6.600 Y SLC48A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_014929.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02696 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02696 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000475992 GTGTGGATTCGGCAATCTTCCTCG pLX_317 18% 100% 100% V5 n/a
4 ccsbBroadEn_14998 pDONR223 0% 100% 100% None n/a
5 ccsbBroad304_14998 pLX_304 0% 100% 100% V5 n/a
6 TRCN0000479904 CACTCGAGGCGGCTCCCTGGCCTC pLX_317 18% 100% 100% V5 n/a
Download CSV