Transcript: Human NM_014964.4

Homo sapiens epsin 2 (EPN2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
EPN2 (22905)
Length:
4835
CDS:
449..2374

Additional Resources:

NCBI RefSeq record:
NM_014964.4
NBCI Gene record:
EPN2 (22905)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_014964.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000222758 CGTGGACAACTCTTGAATTAA pLKO.1 2884 3UTR 100% 15.000 12.000 N EPN2 n/a
2 TRCN0000077915 GACTACGCTGTTGGATTTAAT pLKO.1 1441 CDS 100% 15.000 12.000 N EPN2 n/a
3 TRCN0000230842 AGTAATCTGAATGGTACAATT pLKO_005 1790 CDS 100% 13.200 10.560 N EPN2 n/a
4 TRCN0000381778 GGGTGATGACCTCAGATTACA pLKO_005 1345 CDS 100% 5.625 4.500 N EPN2 n/a
5 TRCN0000077916 CCCTGCAATGATGAACATGGT pLKO.1 2287 CDS 100% 2.640 2.112 N EPN2 n/a
6 TRCN0000218622 AGACTACGCTGTTGGATTTAA pLKO_005 1440 CDS 100% 15.000 10.500 N EPN2 n/a
7 TRCN0000230844 CGGCACAGGAGAGATCTTAAA pLKO_005 4149 3UTR 100% 13.200 9.240 N EPN2 n/a
8 TRCN0000230843 ATGGTGGGCAGTGTGGGTATA pLKO_005 2303 CDS 100% 10.800 7.560 N EPN2 n/a
9 TRCN0000230841 GCAGCAACCAGATCACCTTTG pLKO_005 933 CDS 100% 6.000 4.200 N EPN2 n/a
10 TRCN0000381140 ACTGGAGCCACCGTACAATCT pLKO_005 1637 CDS 100% 4.950 3.465 N EPN2 n/a
11 TRCN0000077914 AGTTCTCTGATGACCGAGATT pLKO.1 557 CDS 100% 4.950 3.465 N EPN2 n/a
12 TRCN0000382507 ATCGTGAACAATTACTCAGAG pLKO_005 485 CDS 100% 4.050 2.835 N EPN2 n/a
13 TRCN0000380384 CAGTTCTCTGATGACCGAGAT pLKO_005 556 CDS 100% 4.050 2.835 N EPN2 n/a
14 TRCN0000077917 GCTCTCCTCAAGGACGAGGAA pLKO.1 842 CDS 100% 0.088 0.062 N EPN2 n/a
15 TRCN0000379624 TGTCTGTCTCTGGGTCCTTTG pLKO_005 1761 CDS 100% 6.000 3.600 N EPN2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_014964.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14071 pDONR223 100% 91% .3% None 4delA;596_766del;1202T>C n/a
2 ccsbBroad304_14071 pLX_304 0% 91% .3% V5 (not translated due to prior stop codon) 4delA;596_766del;1202T>C n/a
3 TRCN0000481307 TAACGCCCAATATAATTTTGCCCT pLX_317 22.7% 91% .3% V5 (not translated due to prior stop codon) 4delA;596_766del;1202T>C n/a
Download CSV