Transcript: Human NM_015073.3

Homo sapiens signal induced proliferation associated 1 like 3 (SIPA1L3), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
SIPA1L3 (23094)
Length:
8004
CDS:
530..5875

Additional Resources:

NCBI RefSeq record:
NM_015073.3
NBCI Gene record:
SIPA1L3 (23094)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_015073.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000182988 CCGATTTATTTGAGAGAGAAA pLKO.1 6547 3UTR 100% 4.950 6.930 N SIPA1L3 n/a
2 TRCN0000183492 GCCGATTTATTTGAGAGAGAA pLKO.1 6546 3UTR 100% 4.950 6.930 N SIPA1L3 n/a
3 TRCN0000147758 GAACCTCAATACTCAAGTCAT pLKO.1 4313 CDS 100% 4.950 3.960 N SIPA1L3 n/a
4 TRCN0000272315 CAAGCAGCCTGTACGCAATAA pLKO_005 4870 CDS 100% 13.200 9.240 N SIPA1L3 n/a
5 TRCN0000284736 CATCGACTCCACCGGCAAATT pLKO_005 3040 CDS 100% 13.200 9.240 N SIPA1L3 n/a
6 TRCN0000272369 TTGCTGGCCAAGGTGATTAAC pLKO_005 2915 CDS 100% 13.200 9.240 N SIPA1L3 n/a
7 TRCN0000284735 GTGGAACCACATTCCGCAAAT pLKO_005 2874 CDS 100% 10.800 7.560 N SIPA1L3 n/a
8 TRCN0000272371 TCTGCACCACGCACAACAAAG pLKO_005 6267 3UTR 100% 10.800 7.560 N SIPA1L3 n/a
9 TRCN0000149732 GCTGGTTCTCTAAAGGCAATA pLKO.1 6955 3UTR 100% 10.800 6.480 N SIPA1L3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015073.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07837 pDONR223 100% 99.9% 99.9% None (many diffs) n/a
2 ccsbBroad304_07837 pLX_304 0% 99.9% 99.9% V5 (many diffs) n/a
3 TRCN0000480568 ACATAGCAAAACTGGCTAAGTTGC pLX_317 6.4% 99.9% 99.9% V5 (many diffs) n/a
Download CSV