Transcript: Human NM_015140.4

Homo sapiens tubulin tyrosine ligase like 12 (TTLL12), mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
TTLL12 (23170)
Length:
3386
CDS:
66..2000

Additional Resources:

NCBI RefSeq record:
NM_015140.4
NBCI Gene record:
TTLL12 (23170)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_015140.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000245457 GAAGATGCCGGTGTGGTATAT pLKO_005 623 CDS 100% 13.200 18.480 N TTLL12 n/a
2 TRCN0000245456 CCCTACGGTTGTTCGTGTATG pLKO_005 1510 CDS 100% 10.800 15.120 N TTLL12 n/a
3 TRCN0000245460 CAATGAGAACTTCAGGTTAAA pLKO_005 2859 3UTR 100% 13.200 9.240 N TTLL12 n/a
4 TRCN0000122228 GAGAAGCAATACCCAGAATTT pLKO.1 1671 CDS 100% 13.200 9.240 N TTLL12 n/a
5 TRCN0000245459 ACGTCTTCAGCACCTTGTTTC pLKO_005 1939 CDS 100% 10.800 7.560 N TTLL12 n/a
6 TRCN0000245458 ACTTCACGGTCATGAACTATG pLKO_005 1597 CDS 100% 10.800 7.560 N TTLL12 n/a
7 TRCN0000141249 CAACCTGATGGGCATTGAGTT pLKO.1 503 CDS 100% 4.950 3.465 N TTLL12 n/a
8 TRCN0000142497 GAAGCACTTCACGGTCATGAA pLKO.1 1592 CDS 100% 4.950 3.465 N TTLL12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015140.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02727 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02727 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000479302 AACGACAATTACGGTTAGGACTAA pLX_317 21.6% 100% 100% V5 n/a
Download CSV