Transcript: Human NM_015177.2

Homo sapiens deltex E3 ubiquitin ligase 4 (DTX4), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
DTX4 (23220)
Length:
6003
CDS:
465..2324

Additional Resources:

NCBI RefSeq record:
NM_015177.2
NBCI Gene record:
DTX4 (23220)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_015177.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000236608 CATTGGCTTTAGCTACGTAAT pLKO_005 848 CDS 100% 10.800 15.120 N DTX4 n/a
2 TRCN0000236609 GGCTACCCAGATGCCAATTAC pLKO_005 2232 CDS 100% 13.200 10.560 N DTX4 n/a
3 TRCN0000236607 TTAAGGCAGCCGTGGTCAATG pLKO_005 1063 CDS 100% 10.800 7.560 N DTX4 n/a
4 TRCN0000040776 CCAGATGCCAATTACCTGGAT pLKO.1 2238 CDS 100% 2.640 1.848 N Dtx4 n/a
5 TRCN0000237898 CTCATCTCCCTCATCTATTAT pLKO_005 3604 3UTR 100% 15.000 9.000 N DTX4 n/a
6 TRCN0000236606 CCCGTCAGCAAGAGTGAAATA pLKO_005 1542 CDS 100% 13.200 7.920 N DTX4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015177.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11698 pDONR223 100% 82.8% 82.8% None 1_318del n/a
2 ccsbBroad304_11698 pLX_304 0% 82.8% 82.8% V5 1_318del n/a
3 TRCN0000465429 GCTCTGGAGTCGTTACAGTTTAGG pLX_317 22.3% 82.8% 82.8% V5 1_318del n/a
Download CSV