Transcript: Human NM_015184.5

Homo sapiens phospholipase C like 2 (PLCL2), transcript variant 2, mRNA.

Source:
NCBI, updated 2018-08-11
Taxon:
Homo sapiens (human)
Gene:
PLCL2 (23228)
Length:
3964
CDS:
254..3259

Additional Resources:

NCBI RefSeq record:
NM_015184.5
NBCI Gene record:
PLCL2 (23228)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_015184.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000235478 TCCGCAGTGTCATTGATATTA pLKO_005 1362 CDS 100% 15.000 21.000 N PLCL2 n/a
2 TRCN0000235481 TCCATAGACGGGTTCACTAAT pLKO_005 1076 CDS 100% 13.200 18.480 N PLCL2 n/a
3 TRCN0000001737 CGGAGTGTTGAATTAGATGTA pLKO.1 1277 CDS 100% 4.950 3.960 N PLCL2 n/a
4 TRCN0000235480 CATGCTTGCTGAGCCATAATT pLKO_005 3701 3UTR 100% 15.000 10.500 N PLCL2 n/a
5 TRCN0000235479 ATTTGTCCACGTGGCTATTAC pLKO_005 2497 CDS 100% 13.200 9.240 N PLCL2 n/a
6 TRCN0000235477 GAACAGGGTGTGGCACATATA pLKO_005 983 CDS 100% 13.200 9.240 N PLCL2 n/a
7 TRCN0000001738 ACTGTGAATGTATGTAGCAAT pLKO.1 3402 3UTR 100% 4.950 3.465 N PLCL2 n/a
8 TRCN0000001740 CAAACGATGAAACTGGAGAAT pLKO.1 3237 CDS 100% 4.950 3.465 N PLCL2 n/a
9 TRCN0000001739 GCTCTATACAACATCACCCAA pLKO.1 1501 CDS 100% 2.640 1.848 N PLCL2 n/a
10 TRCN0000001741 CCGAGGTCACAAAGGAAGAAT pLKO.1 846 CDS 100% 5.625 3.375 N PLCL2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015184.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07858 pDONR223 100% 99.8% 99.5% None (many diffs) n/a
2 ccsbBroad304_07858 pLX_304 0% 99.8% 99.5% V5 (many diffs) n/a
3 TRCN0000478617 ATAATACTTTAATGACCGAAGTTC pLX_317 11.4% 99.8% 99.5% V5 (many diffs) n/a
Download CSV