Transcript: Human NM_015430.4

Homo sapiens peptidase domain containing associated with muscle regeneration 1 (PAMR1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
PAMR1 (25891)
Length:
2774
CDS:
32..2245

Additional Resources:

NCBI RefSeq record:
NM_015430.4
NBCI Gene record:
PAMR1 (25891)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_015430.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000056038 CCTGCCGAGAACCAAAGATTT pLKO.1 1116 CDS 100% 13.200 18.480 N PAMR1 n/a
2 TRCN0000372045 GACGGTTTCCATGCCATTTAT pLKO_005 710 CDS 100% 15.000 10.500 N PAMR1 n/a
3 TRCN0000372101 GGTCAGCTGGAGCTATGATAA pLKO_005 2146 CDS 100% 13.200 9.240 N PAMR1 n/a
4 TRCN0000056042 CCAGGTTGTACCATCTTTGAA pLKO.1 278 CDS 100% 5.625 3.938 N PAMR1 n/a
5 TRCN0000056041 GAGCCTACAGATTTCTGCTAT pLKO.1 1699 CDS 100% 4.950 3.465 N PAMR1 n/a
6 TRCN0000056040 GCCAAGAGAGTACACAGTCAT pLKO.1 97 CDS 100% 4.950 3.465 N PAMR1 n/a
7 TRCN0000056039 CCAACTAAGATTTGTCATGTT pLKO.1 517 CDS 100% 4.950 2.970 N PAMR1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015430.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02880 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02880 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000477550 GGCTCTTTACCACCTTGGTCTCTG pLX_317 17.5% 100% 100% V5 n/a
Download CSV