Transcript: Human NM_015490.4

Homo sapiens SEC31 homolog B, COPII coat complex component (SEC31B), mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
SEC31B (25956)
Length:
4634
CDS:
126..3665

Additional Resources:

NCBI RefSeq record:
NM_015490.4
NBCI Gene record:
SEC31B (25956)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_015490.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000232787 GGAGCAGTGAGGTGGTATATA pLKO_005 997 CDS 100% 15.000 10.500 N SEC31B n/a
2 TRCN0000232791 TCTCATCTGCCGGCATTATTA pLKO_005 4257 3UTR 100% 15.000 10.500 N SEC31B n/a
3 TRCN0000232788 CATCTCAGCCACAGCTATTAG pLKO_005 2779 CDS 100% 13.200 9.240 N SEC31B n/a
4 TRCN0000232789 CCAGCGTCTGGAGTATCTATA pLKO_005 3443 CDS 100% 13.200 9.240 N SEC31B n/a
5 TRCN0000147107 CCATTCCTTCTGTGATGATAA pLKO.1 4422 3UTR 100% 13.200 9.240 N SEC31B n/a
6 TRCN0000232790 TGTCCTCATCATCGCTCATAA pLKO_005 3632 CDS 100% 13.200 9.240 N SEC31B n/a
7 TRCN0000149659 GCCATTCCTTCTGTGATGATA pLKO.1 4421 3UTR 100% 5.625 3.938 N SEC31B n/a
8 TRCN0000148627 CCAGCGATTCTGAAATCTTCA pLKO.1 547 CDS 100% 4.950 3.465 N SEC31B n/a
9 TRCN0000147282 GATCAGTTTGTACTCTGTGAT pLKO.1 1106 CDS 100% 4.950 3.465 N SEC31B n/a
10 TRCN0000149841 CCCAAATGGATTAGAAGACCA pLKO.1 1266 CDS 100% 2.640 1.848 N SEC31B n/a
11 TRCN0000150017 CCTATCATCAAAGTCAGTGAT pLKO.1 732 CDS 100% 4.950 2.970 N SEC31B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015490.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11790 pDONR223 100% 29.3% 29.1% None (many diffs) n/a
2 ccsbBroad304_11790 pLX_304 0% 29.3% 29.1% V5 (many diffs) n/a
3 TRCN0000468299 GCCTTAGACCTTAACTAATAAATT pLX_317 29.2% 29.3% 29.1% V5 (many diffs) n/a
Download CSV