Transcript: Human NM_015507.4

Homo sapiens EGF like domain multiple 6 (EGFL6), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
EGFL6 (25975)
Length:
2403
CDS:
262..1923

Additional Resources:

NCBI RefSeq record:
NM_015507.4
NBCI Gene record:
EGFL6 (25975)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_015507.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000056079 GCAGGTCACAAGAAAGACATT pLKO.1 1579 CDS 100% 4.950 6.930 N EGFL6 n/a
2 TRCN0000056081 GTCGGGAAACTTCGAGTGTTT pLKO.1 1684 CDS 100% 4.950 6.930 N EGFL6 n/a
3 TRCN0000056082 CGTGTGTGAACTCTAGGACAT pLKO.1 653 CDS 100% 4.050 5.670 N EGFL6 n/a
4 TRCN0000435338 CTGAATCTTTCCACATTATAT pLKO_005 2125 3UTR 100% 15.000 10.500 N EGFL6 n/a
5 TRCN0000422547 TAAATGCAAGCAGGGATATAA pLKO_005 996 CDS 100% 15.000 10.500 N EGFL6 n/a
6 TRCN0000420528 GACTGAATGTTACTATCTTTA pLKO_005 1918 CDS 100% 13.200 9.240 N EGFL6 n/a
7 TRCN0000424261 GAGCTTCTCTCTACAACATTT pLKO_005 2213 3UTR 100% 13.200 9.240 N EGFL6 n/a
8 TRCN0000056080 GCCAACACAGATGTGTGAATA pLKO.1 575 CDS 100% 13.200 9.240 N EGFL6 n/a
9 TRCN0000056078 CCCTTCAACTATGAAGAGATA pLKO.1 1204 CDS 100% 0.495 0.347 N EGFL6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015507.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02895 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02895 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000476891 TCCTCGACTCAAAGTGTCATTTAC pLX_317 23.9% 99.9% 99.8% V5 1648T>C n/a
Download CSV