Transcript: Human NM_015550.4

Homo sapiens oxysterol binding protein like 3 (OSBPL3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
OSBPL3 (26031)
Length:
6749
CDS:
443..3106

Additional Resources:

NCBI RefSeq record:
NM_015550.4
NBCI Gene record:
OSBPL3 (26031)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_015550.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000275975 GCCAAGAGCCAAACCGATATA pLKO_005 692 CDS 100% 13.200 18.480 N OSBPL3 n/a
2 TRCN0000285469 TGCGTAAGCTACCCAAGTTTA pLKO_005 3526 3UTR 100% 13.200 18.480 N OSBPL3 n/a
3 TRCN0000157183 GCCTTTGCCATATCAGCGTAT pLKO.1 2201 CDS 100% 4.050 5.670 N OSBPL3 n/a
4 TRCN0000276022 GCCTTTGCCATATCAGCGTAT pLKO_005 2201 CDS 100% 4.050 5.670 N OSBPL3 n/a
5 TRCN0000155275 GCTGGAAGCAAGCCATTTAAT pLKO.1 2240 CDS 100% 15.000 10.500 N OSBPL3 n/a
6 TRCN0000281980 GCTGGAAGCAAGCCATTTAAT pLKO_005 2240 CDS 100% 15.000 10.500 N OSBPL3 n/a
7 TRCN0000151606 GAAGCGTAGCAGTATATCAAA pLKO.1 988 CDS 100% 5.625 3.938 N OSBPL3 n/a
8 TRCN0000276032 GAAGCGTAGCAGTATATCAAA pLKO_005 988 CDS 100% 5.625 3.938 N OSBPL3 n/a
9 TRCN0000158226 CGTGGCATCATTTGGGAAGAA pLKO.1 5435 3UTR 100% 4.950 3.465 N OSBPL3 n/a
10 TRCN0000152169 CAAAGTCTTTATTGCCACCTA pLKO.1 2838 CDS 100% 2.640 1.848 N OSBPL3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015550.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000479773 TTGCCTTGAAAGTTTAACACCAAT pLX_317 13.2% 99.9% 100% V5 753G>A n/a
2 ccsbBroadEn_14104 pDONR223 100% 99.9% 99.7% None 753G>A;2656delT n/a
3 ccsbBroad304_14104 pLX_304 0% 99.9% 99.7% V5 (not translated due to frame shift) 753G>A;2656delT n/a
Download CSV