Transcript: Human NM_015622.6

Homo sapiens CCZ1 homolog, vacuolar protein trafficking and biogenesis associated (CCZ1), mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
CCZ1 (51622)
Length:
2379
CDS:
68..1516

Additional Resources:

NCBI RefSeq record:
NM_015622.6
NBCI Gene record:
CCZ1 (51622)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_015622.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000421603 GGTTGTTCGGAATCCTATAAT pLKO_005 379 CDS 100% 15.000 7.500 Y CCZ1B n/a
2 TRCN0000434755 AGCTTCTTCCCGTTGGATAAA pLKO_005 647 CDS 100% 13.200 6.600 Y CCZ1B n/a
3 TRCN0000162374 CATGCAAGTTAGTGGTCATAT pLKO.1 1572 3UTR 100% 13.200 6.600 Y CCZ1B n/a
4 TRCN0000434255 GAAATTCTTCCATCGGTATTT pLKO_005 574 CDS 100% 13.200 6.600 Y CCZ1 n/a
5 TRCN0000417835 GAGCTCCATTTAATCGTTTAT pLKO_005 998 CDS 100% 13.200 6.600 Y CCZ1 n/a
6 TRCN0000161409 GAGTTGTTGGACAAGGTTTAT pLKO.1 449 CDS 100% 13.200 6.600 Y CCZ1B n/a
7 TRCN0000422714 TGGTTGTTCGGAATCCTATAA pLKO_005 378 CDS 100% 13.200 6.600 Y CCZ1 n/a
8 TRCN0000417975 TTGGCTATATCGCTATCATTT pLKO_005 1714 3UTR 100% 13.200 6.600 Y CCZ1 n/a
9 TRCN0000421283 ATGAAGATGAGGAGATCATTG pLKO_005 1338 CDS 100% 10.800 5.400 Y CCZ1 n/a
10 TRCN0000425501 ATTTGGTCACATGCAAGTTAG pLKO_005 1563 3UTR 100% 10.800 5.400 Y CCZ1 n/a
11 TRCN0000129615 CAGCTTCTTCCCGTTGGATAA pLKO.1 646 CDS 100% 10.800 5.400 Y CCZ1 n/a
12 TRCN0000426583 GCATTCAGGACAAGGGTAAAG pLKO_005 1601 3UTR 100% 10.800 5.400 Y CCZ1 n/a
13 TRCN0000128482 GATGAAGATGAGGAGATCATT pLKO.1 1337 CDS 100% 5.625 2.813 Y CCZ1 n/a
14 TRCN0000158946 GCAATACTTGCTTTGAAGAAT pLKO.1 1621 3UTR 100% 5.625 2.813 Y CCZ1B n/a
15 TRCN0000165023 GCTCACCGAGAGCATATCTAA pLKO.1 1526 3UTR 100% 5.625 2.813 Y CCZ1B n/a
16 TRCN0000129224 CAAGGACATTTAGCCCATCAA pLKO.1 282 CDS 100% 4.950 2.475 Y CCZ1 n/a
17 TRCN0000128672 CCAGGAAATCTTCAACACTAT pLKO.1 884 CDS 100% 4.950 2.475 Y CCZ1 n/a
18 TRCN0000162126 CCCGGATTTAATGAAGATTCT pLKO.1 1285 CDS 100% 4.950 2.475 Y CCZ1B n/a
19 TRCN0000129349 CGAGAAGAGCACAGTTCACAT pLKO.1 1228 CDS 100% 4.950 2.475 Y CCZ1 n/a
20 TRCN0000166818 CGGTGACATCAACAGTGACTT pLKO.1 1306 CDS 100% 4.950 2.475 Y CCZ1B n/a
21 TRCN0000162928 GCACCCGGATTTAATGAAGAT pLKO.1 1282 CDS 100% 4.950 2.475 Y CCZ1B n/a
22 TRCN0000182667 GCAGTGCTACAGCATGTACAA pLKO.1 484 CDS 100% 4.950 2.475 Y Ccz1 n/a
23 TRCN0000128235 GCAGTTCAACAACATCTTCTT pLKO.1 1486 CDS 100% 4.950 2.475 Y CCZ1 n/a
24 TRCN0000128294 GCTGAGTTTCTTCATCTACAA pLKO.1 139 CDS 100% 4.950 2.475 Y CCZ1 n/a
25 TRCN0000160920 GAGAAATTCTTCCATCGGTAT pLKO.1 572 CDS 100% 4.050 2.025 Y CCZ1B n/a
26 TRCN0000128295 GATTCTCCAATAAGAGCAGAA pLKO.1 860 CDS 100% 4.050 2.025 Y CCZ1 n/a
27 TRCN0000181233 CAGTCATGTGACCTACTTGAT pLKO.1 611 CDS 100% 4.950 2.475 Y Ccz1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015622.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08329 pDONR223 99.7% 99.8% 99.7% None 759T>C;1421A>C n/a
2 ccsbBroadEn_05267 pDONR223 100% 99.8% 100% None 759T>C;1104C>T n/a
3 ccsbBroad304_05267 pLX_304 0% 99.8% 100% V5 759T>C;1104C>T n/a
Download CSV