Transcript: Human NM_015641.4

Homo sapiens testin LIM domain protein (TES), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
TES (26136)
Length:
2736
CDS:
170..1435

Additional Resources:

NCBI RefSeq record:
NM_015641.4
NBCI Gene record:
TES (26136)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_015641.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000150892 GAGATATACGTGATGGTCAAT pLKO.1 1181 CDS 100% 4.950 6.930 N TES n/a
2 TRCN0000353585 GAGATATACGTGATGGTCAAT pLKO_005 1181 CDS 100% 4.950 6.930 N TES n/a
3 TRCN0000330004 CGAAAGGGCTGGCTATGATAA pLKO_005 925 CDS 100% 13.200 10.560 N TES n/a
4 TRCN0000155821 CGAACTGCACTTCTGGAGAAA pLKO.1 265 CDS 100% 4.950 3.960 N TES n/a
5 TRCN0000151584 GCTGATATTCAGCAATGAGTA pLKO.1 1087 CDS 100% 4.950 3.960 N TES n/a
6 TRCN0000330002 GCTGATATTCAGCAATGAGTA pLKO_005 1087 CDS 100% 4.950 3.960 N TES n/a
7 TRCN0000217454 GAAAGGGCTGGCTATGATAAA pLKO.1 926 CDS 100% 13.200 9.240 N Gm4985 n/a
8 TRCN0000153030 GAGCAATGAAGAGGATCGAAA pLKO.1 334 CDS 100% 4.950 3.465 N TES n/a
9 TRCN0000155344 GCAGAAGTTCATGCCAGTAGA pLKO.1 1369 CDS 100% 4.950 3.465 N TES n/a
10 TRCN0000151065 GCATAACAGTATCCACACTTT pLKO.1 2112 3UTR 100% 4.950 3.465 N TES n/a
11 TRCN0000330031 GCATAACAGTATCCACACTTT pLKO_005 2112 3UTR 100% 4.950 3.465 N TES n/a
12 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2320 3UTR 100% 5.625 2.813 Y KLHL30 n/a
13 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2320 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015641.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02922 pDONR223 99.2% 100% 100% None n/a
2 ccsbBroad304_02922 pLX_304 0% 100% 100% V5 (not translated due to prior stop codon) n/a
3 TRCN0000467108 ATCGAAGTGTATTTATCACAGTGT pLX_317 21.2% 100% 100% V5 (not translated due to prior stop codon) n/a
Download CSV