Transcript: Human NM_015710.5

Homo sapiens NOP53 ribosome biogenesis factor (NOP53), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
NOP53 (29997)
Length:
1504
CDS:
15..1451

Additional Resources:

NCBI RefSeq record:
NM_015710.5
NBCI Gene record:
NOP53 (29997)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_015710.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000038091 CAAACGCAAGTACAAGGTGAA pLKO.1 1391 CDS 100% 4.050 2.835 N NOP53 n/a
2 TRCN0000038092 AGCTTCCTACAATCCATCCTT pLKO.1 746 CDS 100% 3.000 2.100 N NOP53 n/a
3 TRCN0000299040 AGCTTCCTACAATCCATCCTT pLKO_005 746 CDS 100% 3.000 2.100 N NOP53 n/a
4 TRCN0000038089 GCTGACAAAGAAGAGAACCAA pLKO.1 305 CDS 100% 3.000 2.100 N NOP53 n/a
5 TRCN0000299041 GCTGACAAAGAAGAGAACCAA pLKO_005 305 CDS 100% 3.000 2.100 N NOP53 n/a
6 TRCN0000038090 GCGAGGCCCAAGAAATAAGAA pLKO.1 128 CDS 100% 5.625 2.813 Y NOP53 n/a
7 TRCN0000310373 GCGAGGCCCAAGAAATAAGAA pLKO_005 128 CDS 100% 5.625 2.813 Y NOP53 n/a
8 TRCN0000038093 GACCAAGAAGAAAGGAGTGAA pLKO.1 662 CDS 100% 4.950 2.475 Y NOP53 n/a
9 TRCN0000299111 GACCAAGAAGAAAGGAGTGAA pLKO_005 662 CDS 100% 4.950 2.475 Y NOP53 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015710.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08157 pDONR223 100% 99.7% 99.7% None 705A>G;1166A>G;1221G>A n/a
2 ccsbBroad304_08157 pLX_304 0% 99.7% 99.7% V5 705A>G;1166A>G;1221G>A n/a
3 TRCN0000479514 ACGTGCCTTATCCCCTGGGAAAAG pLX_317 24.6% 99.7% 99.7% V5 705A>G;1166A>G;1221G>A n/a
Download CSV