Transcript: Human NM_015720.4

Homo sapiens podocalyxin like 2 (PODXL2), mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
PODXL2 (50512)
Length:
2175
CDS:
36..1853

Additional Resources:

NCBI RefSeq record:
NM_015720.4
NBCI Gene record:
PODXL2 (50512)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_015720.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000172549 GAGACATGGAACTGACACCTT pLKO.1 1051 CDS 100% 2.640 3.696 N PODXL2 n/a
2 TRCN0000172575 GCTGAAGCTCAATCCAGGATA pLKO.1 1128 CDS 100% 4.950 3.960 N PODXL2 n/a
3 TRCN0000245518 TGAACATGACAGAGAACATAG pLKO_005 1216 CDS 100% 10.800 7.560 N PODXL2 n/a
4 TRCN0000245515 GGGACCCACTGCAGATTATGT pLKO_005 371 CDS 100% 5.625 3.938 N PODXL2 n/a
5 TRCN0000245517 AGATTGGCATCCAGAACTATT pLKO_005 1459 CDS 100% 13.200 7.920 N PODXL2 n/a
6 TRCN0000245516 CCATCTGCATCATCATCATTG pLKO_005 1564 CDS 100% 10.800 6.480 N PODXL2 n/a
7 TRCN0000245519 CTTGCCTTCATTCCCTCAAAC pLKO_005 950 CDS 100% 10.800 6.480 N PODXL2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015720.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08176 pDONR223 100% 99.9% 100% None 399C>T n/a
2 ccsbBroadEn_11923 pDONR223 100% 87.4% 87.4% None 1003_1230del n/a
3 ccsbBroad304_11923 pLX_304 0% 87.4% 87.4% V5 1003_1230del n/a
Download CSV