Transcript: Mouse NM_015736.2

Mus musculus UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 3 (Galnt3), mRNA.

Source:
NCBI, updated 2017-05-06
Taxon:
Mus musculus (mouse)
Gene:
Galnt3 (14425)
Length:
3684
CDS:
379..2280

Additional Resources:

NCBI RefSeq record:
NM_015736.2
NBCI Gene record:
Galnt3 (14425)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_015736.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000055099 CGGAAGGACCAACTTCTATAT pLKO.1 2152 CDS 100% 13.200 18.480 N Galnt3 n/a
2 TRCN0000363402 GCAAATAGGAGCGCCCATTAA pLKO_005 618 CDS 100% 13.200 18.480 N Galnt3 n/a
3 TRCN0000055101 GCAATGCCAAAGATGCAAATA pLKO.1 604 CDS 100% 13.200 10.560 N Galnt3 n/a
4 TRCN0000055100 CCACCTGAATGTATTGAACAA pLKO.1 886 CDS 100% 4.950 3.960 N Galnt3 n/a
5 TRCN0000363386 CATCGCATCCATAGATCTAAA pLKO_005 1293 CDS 100% 13.200 9.240 N Galnt3 n/a
6 TRCN0000035455 CCAGACCTTAATCCTGTTATA pLKO.1 1873 CDS 100% 13.200 9.240 N GALNT3 n/a
7 TRCN0000055098 GCAACCATAACCGTGGAAATT pLKO.1 1349 CDS 100% 13.200 9.240 N Galnt3 n/a
8 TRCN0000055102 GTCTGGATGTTGGTGAGAATA pLKO.1 1928 CDS 100% 13.200 9.240 N Galnt3 n/a
9 TRCN0000363398 CCGTACGGAAGCAACCATAAC pLKO_005 1339 CDS 100% 10.800 7.560 N Galnt3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015736.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00613 pDONR223 100% 87% 91.9% None (many diffs) n/a
2 ccsbBroad304_00613 pLX_304 0% 87% 91.9% V5 (many diffs) n/a
3 TRCN0000471154 AATTATGGTTGCATTTCTCCAATC pLX_317 24.2% 87% 91.9% V5 (many diffs) n/a
Download CSV