Transcript: Mouse NM_015771.2

Mus musculus large tumor suppressor 2 (Lats2), transcript variant A, mRNA.

Source:
NCBI, updated 2017-06-18
Taxon:
Mus musculus (mouse)
Gene:
Lats2 (50523)
Length:
5213
CDS:
437..3565

Additional Resources:

NCBI RefSeq record:
NM_015771.2
NBCI Gene record:
Lats2 (50523)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_015771.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000022708 CGACCTGGATGGTCATATTAA pLKO.1 2707 CDS 100% 15.000 21.000 N Lats2 n/a
2 TRCN0000374387 CTCTCAGGGAAATCCGATATT pLKO_005 660 CDS 100% 13.200 18.480 N Lats2 n/a
3 TRCN0000022706 CCGAAGTTTGGACCTTATCAA pLKO.1 635 CDS 100% 5.625 7.875 N Lats2 n/a
4 TRCN0000022705 CGCAAGAATAGCAGAGATGAA pLKO.1 2051 CDS 100% 4.950 3.960 N Lats2 n/a
5 TRCN0000274682 CGCAAGAATAGCAGAGATGAA pLKO_005 2051 CDS 100% 4.950 3.960 N Lats2 n/a
6 TRCN0000274683 GAGGACCTTCACTGCATTAAA pLKO_005 3704 3UTR 100% 15.000 10.500 N Lats2 n/a
7 TRCN0000274681 TCGCTGTGGAGACAGGTTAAA pLKO_005 2854 CDS 100% 13.200 9.240 N Lats2 n/a
8 TRCN0000022704 CCGCTTCTACATTGCAGAGTT pLKO.1 2614 CDS 100% 4.950 3.465 N Lats2 n/a
9 TRCN0000274744 CCGCTTCTACATTGCAGAGTT pLKO_005 2614 CDS 100% 4.950 3.465 N Lats2 n/a
10 TRCN0000022707 CGCCTTCTATGAGTTCACCTT pLKO.1 3415 CDS 100% 2.640 1.584 N Lats2 n/a
11 TRCN0000323508 CGCCTTCTATGAGTTCACCTT pLKO_005 3415 CDS 100% 2.640 1.584 N Lats2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015771.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15036 pDONR223 100% 40.6% 22.8% None (many diffs) n/a
2 ccsbBroad304_15036 pLX_304 0% 40.6% 22.8% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000467147 ATCACCGGTGCAAGCGATCAAGAT pLX_317 23.3% 40.6% 22.8% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV