Transcript: Mouse NM_015787.4

Mus musculus histone cluster 1, H1e (Hist1h1e), mRNA.

Source:
NCBI, updated 2017-04-23
Taxon:
Mus musculus (mouse)
Gene:
Hist1h1e (50709)
Length:
782
CDS:
62..721

Additional Resources:

NCBI RefSeq record:
NM_015787.4
NBCI Gene record:
Hist1h1e (50709)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_015787.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000096936 CGCCGAGAAGACACCCGTCAA pLKO.1 103 CDS 100% 0.000 0.000 N Hist1h1e n/a
2 TRCN0000096937 CAAAGGCAACTAAGGCTAAGA pLKO.1 588 CDS 100% 4.950 3.465 N Hist1h1e n/a
3 TRCN0000096935 GTAAAGCCTAAAGCGGCCAAA pLKO.1 641 CDS 100% 4.050 2.835 N Hist1h1e n/a
4 TRCN0000096938 CCTCCAAGCCTAAGGCAGCTA pLKO.1 669 CDS 100% 0.880 0.528 N Hist1h1e n/a
5 TRCN0000093035 CGGCTCCTTCAAACTCAACAA pLKO.1 367 CDS 100% 4.950 2.475 Y Hist1h1c n/a
6 TRCN0000106804 CTCCTTCAAACTCAACAAGAA pLKO.1 370 CDS 100% 4.950 2.475 Y H1-3 n/a
7 TRCN0000369850 GAAGAACAACAGCCGCATCAA pLKO_005 283 CDS 100% 4.950 2.475 Y H1-4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015787.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00715 pDONR223 100% 86.1% 94% None (many diffs) n/a
2 TRCN0000467159 AGTATACGATAATTTCTCCAAAAA pLX_317 57.5% 86.1% 94% V5 (many diffs) n/a
3 ccsbBroad304_00715 pLX_304 76.1% 85.9% 93.6% V5 (many diffs) n/a
Download CSV