Transcript: Human NM_015894.4

Homo sapiens stathmin 3 (STMN3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
STMN3 (50861)
Length:
2248
CDS:
80..622

Additional Resources:

NCBI RefSeq record:
NM_015894.4
NBCI Gene record:
STMN3 (50861)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_015894.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000438396 CGACAGAACACGTTCGGGTTT pLKO_005 651 3UTR 100% 4.050 5.670 N STMN3 n/a
2 TRCN0000418081 CCTCTGTCTAGATGCAACTTT pLKO_005 689 3UTR 100% 5.625 3.938 N STMN3 n/a
3 TRCN0000063856 CGCTGGAGGAGAATAACAACT pLKO.1 441 CDS 100% 4.950 3.465 N STMN3 n/a
4 TRCN0000447448 CCCAATACCGTCTACCAGTAC pLKO_005 170 CDS 100% 4.050 2.835 N STMN3 n/a
5 TRCN0000063854 CTACAAGATGGAGCTCAGCAA pLKO.1 490 CDS 100% 2.640 1.848 N STMN3 n/a
6 TRCN0000184270 GCTCAACTACAAGATGGAGCT pLKO.1 484 CDS 100% 2.160 1.512 N Stmn3 n/a
7 TRCN0000063855 GTCGCTCATCTGCTCCTGCTT pLKO.1 133 CDS 100% 0.880 0.616 N STMN3 n/a
8 TRCN0000063853 GCGAGAAGAGATGTCGGGCTA pLKO.1 601 CDS 100% 0.720 0.504 N STMN3 n/a
9 TRCN0000063857 CCTCCCTGGAGGAGCTGCAAA pLKO.1 318 CDS 100% 0.000 0.000 N STMN3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015894.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03160 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03160 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000471016 TTACCCTGTGGCAGGCATAGTCTG pLX_317 66.7% 100% 100% V5 n/a
Download CSV