Transcript: Human NM_015918.4

Homo sapiens POP5 homolog, ribonuclease P/MRP subunit (POP5), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
POP5 (51367)
Length:
1086
CDS:
41..532

Additional Resources:

NCBI RefSeq record:
NM_015918.4
NBCI Gene record:
POP5 (51367)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_015918.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000049671 GAAGTTCCTAATTCAGTACAA pLKO.1 373 CDS 100% 4.950 6.930 N POP5 n/a
2 TRCN0000290734 GAAGTTCCTAATTCAGTACAA pLKO_005 373 CDS 100% 4.950 6.930 N POP5 n/a
3 TRCN0000049672 TGGGAGGTACAATAAGAACAT pLKO.1 348 CDS 100% 4.950 6.930 N POP5 n/a
4 TRCN0000290667 TGGGAGGTACAATAAGAACAT pLKO_005 348 CDS 100% 4.950 6.930 N POP5 n/a
5 TRCN0000049669 CTGTGACAAGAAGCTGCTTAT pLKO.1 462 CDS 100% 10.800 7.560 N POP5 n/a
6 TRCN0000290738 CTGTGACAAGAAGCTGCTTAT pLKO_005 462 CDS 100% 10.800 7.560 N POP5 n/a
7 TRCN0000049668 CATCACATACTTGGAGAACAA pLKO.1 289 CDS 100% 4.950 3.465 N POP5 n/a
8 TRCN0000290736 CATCACATACTTGGAGAACAA pLKO_005 289 CDS 100% 4.950 3.465 N POP5 n/a
9 TRCN0000049670 GTTCGATATCTCAATGCCTAT pLKO.1 203 CDS 100% 4.050 2.835 N POP5 n/a
10 TRCN0000290669 GTTCGATATCTCAATGCCTAT pLKO_005 203 CDS 100% 4.050 2.835 N POP5 n/a
11 TRCN0000148469 CTGGGTTCAAGCAATTCTCTT pLKO.1 1005 3UTR 100% 4.950 2.475 Y C16orf89 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015918.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08280 pDONR223 100% 99.7% 100% None 442T>C n/a
2 ccsbBroad304_08280 pLX_304 0% 99.7% 100% V5 442T>C n/a
3 TRCN0000470319 TCTCGGTCTATATCAGCGATGACG pLX_317 69.9% 99.7% 100% V5 442T>C n/a
4 TRCN0000489591 AACTCCGGTTCCAACATGTTCTTA pLX_317 69.7% 99.7% 100% V5 (not translated due to prior stop codon) 442T>C n/a
Download CSV