Transcript: Human NM_015946.5

Homo sapiens pelota mRNA surveillance and ribosome rescue factor (PELO), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
PELO (53918)
Length:
4371
CDS:
1010..2167

Additional Resources:

NCBI RefSeq record:
NM_015946.5
NBCI Gene record:
PELO (53918)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_015946.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000322754 ACGATGCCTATGCAGTATATT pLKO_005 2457 3UTR 100% 15.000 21.000 N PELO n/a
2 TRCN0000322756 CGTACTACCATCTTGATTAAA pLKO_005 2366 3UTR 100% 15.000 21.000 N PELO n/a
3 TRCN0000163394 GCAGTGAAGACCGACAACAAA pLKO.1 1682 CDS 100% 5.625 7.875 N PELO n/a
4 TRCN0000158912 CGTACAATTAGTAGACTTGAA pLKO.1 2686 3UTR 100% 4.950 6.930 N PELO n/a
5 TRCN0000322752 TATGAGTTATCTGTAGTACTT pLKO_005 2409 3UTR 100% 4.950 6.930 N PELO n/a
6 TRCN0000162217 CGCCACATACACTTTGATGTT pLKO.1 1592 CDS 100% 4.950 3.960 N PELO n/a
7 TRCN0000322755 TATATTGTTTGGGATAGATTG pLKO_005 2472 3UTR 100% 10.800 7.560 N PELO n/a
8 TRCN0000158883 GCTATCTTATCCTGTTTACAT pLKO.1 2544 3UTR 100% 5.625 3.938 N PELO n/a
9 TRCN0000159913 CACATACACTTTGATGTTGTA pLKO.1 1595 CDS 100% 4.950 3.465 N PELO n/a
10 TRCN0000322693 GTGTTCTTGCATTGCATTTAA pLKO_005 2590 3UTR 100% 15.000 9.000 N PELO n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015946.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08355 pDONR223 100% 99.9% 99.7% None 661C>A n/a
2 ccsbBroad304_08355 pLX_304 0% 99.9% 99.7% V5 (not translated due to frame shift) 661C>A n/a
3 TRCN0000465500 CTAACCAATAGCTGTCCCTCGACA pLX_317 5.8% 99.9% 99.7% V5 (not translated due to frame shift) 661C>A n/a
Download CSV