Transcript: Human NM_015956.3

Homo sapiens mitochondrial ribosomal protein L4 (MRPL4), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
MRPL4 (51073)
Length:
1218
CDS:
41..976

Additional Resources:

NCBI RefSeq record:
NM_015956.3
NBCI Gene record:
MRPL4 (51073)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_015956.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000294148 CCGTACTCCTCGTGGACTTAA pLKO_005 684 CDS 100% 13.200 10.560 N MRPL4 n/a
2 TRCN0000117385 CTCTAGGCTTAAGACCTTCAA pLKO.1 742 CDS 100% 4.950 3.960 N MRPL4 n/a
3 TRCN0000286822 CTCTAGGCTTAAGACCTTCAA pLKO_005 742 CDS 100% 4.950 3.960 N MRPL4 n/a
4 TRCN0000294095 ATCCCGGCTGTTGGCCTAAAT pLKO_005 767 CDS 100% 13.200 9.240 N MRPL4 n/a
5 TRCN0000117382 CAAGAGAATTAGCTATGCCAA pLKO.1 358 CDS 100% 2.640 1.848 N MRPL4 n/a
6 TRCN0000117384 CACAAGTTACTACTACATGCT pLKO.1 514 CDS 100% 2.640 1.848 N MRPL4 n/a
7 TRCN0000286747 CACAAGTTACTACTACATGCT pLKO_005 514 CDS 100% 2.640 1.848 N MRPL4 n/a
8 TRCN0000117383 CTGCACATCATGGACTCCCTA pLKO.1 599 CDS 100% 2.640 1.848 N MRPL4 n/a
9 TRCN0000306871 CCCTTCATTCCACGGAGGAAG pLKO_005 1069 3UTR 100% 1.350 0.945 N MRPL4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015956.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03192 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03192 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000467695 TCGGAGTAGTGTCCACTCGACCTA pLX_317 49.7% 100% 100% V5 n/a
4 ccsbBroadEn_14134 pDONR223 100% 83.4% 3.5% None (many diffs) n/a
5 ccsbBroad304_14134 pLX_304 0% 83.4% 3.5% V5 (not translated due to prior stop codon) (many diffs) n/a
6 TRCN0000479985 AGTCTCAATAGTCCTGGATCTAAT pLX_317 45.9% 83.4% 3.5% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV